As readers of my bank know, I have an interest in wild brews and purifying wild yeasts. I have gone through a series of wild yeast collection attempts, and finally have some success to report (more on that below the fold). In addition, over the past few years I've acquired wild yeasts harvested by other brewers - including the infamous/famous Brettanomyces strains from DCYeast.
I'm splitting off the wild yeasts from my yeast bank of commercial (e.g. Wyeast/White labs/bottle cultured) yeasts. I realize this is a somewhat artificial division, as within the commercial yeasts are yeasts that breweries harvested from the wild, but regardless, I figured this was the best division. The new bank of yeast is still rather small, but it should grow quickly as I purify strains from some successful wild brews I have recently conducted (again, more below the fold). For those of you who like my yeast-culturing videos, you'll be happy to know that I'm using this year's wild-yeast hunt to prepare a video covering the process of isolating pure strains of wild-yeast from beginning-to-end, so watch out for that - it should be up soon.
My "vision" for the wild yeast bank is akin to that of Bootleg Biology, namely a terroir-style project, but in my case the goal is to gather these largely from Canada (although I'm happy to bank wild yeasts from any terroir).
A blog on craft beer, home brewing, and yeast wrangeling
Sui Generis Brewing Has Moved
Sui Generis Brewing has moved to a new website, located at http://www.suigenerisbrewing.com. No additional posts will be made here at blogspot and commenting has been disabled. I encourage you to redirect your RSS feed to the updated feed, and to update your bookmarks.
Thank you for all your support over the past 5 years, and I hope you will join me in my new endeavor, over at http://www.suigenerisbrewing.com
Friday, 26 September 2014
Monday, 22 September 2014
A Post Worth Reading
I don't often promote other bloggers posts - which is something I need to fix - so to get that ball rolling I'd like to link everyone to this blog post over at Ben's Beer Blog: Labatt is planning an expensive, intentionally misleading ad campaign for Shock Top.
The blog post is essentially a break-down of Labatt's (a subsidiary of In-Bev, which also owns Budweiser) strategy to mislead customers into thinking some of Labatts products are craft beers. It highlights some of the underhanded methods used by "big beer" to squash their craft brewer competition (that's the bad news). The good news is that it also shows just how damaging craft brewing is becoming to the big guys.
The blog post is essentially a break-down of Labatt's (a subsidiary of In-Bev, which also owns Budweiser) strategy to mislead customers into thinking some of Labatts products are craft beers. It highlights some of the underhanded methods used by "big beer" to squash their craft brewer competition (that's the bad news). The good news is that it also shows just how damaging craft brewing is becoming to the big guys.
Sunday, 21 September 2014
Is this beer cursed?
![]() |
| One full mashtun! |
But, as the title suggests, things have not gone well. This time the problem is something else - I usually condition my grain prior to milling. I find that this greatly reduces the risk of a stuck sparge without hurting my efficiency. Not so this time - my efficiency is down 10%, and I'm pretty sure its because I lost track of how much water I conditioned with and thus over-did it.
To help fix this I collected a few extra litres of run-off and am extending my boil time slightly. But even so, I'm not getting the 9% beer I was hoping for, and instead it will be kicking around 7%.
I need a victory - I think my next beer needs to be something simple, something beyond even my ability to screw up. Malt-extract and hops, here I come
Sunday, 14 September 2014
Tasting Notes: 50,002
Although I've been plagued with a series of infected brews lately, I have managed to prepare one brew during the infection-fest. My 50,002 was a partigyle'd beer brewed off of my (unfortunately infected) all-brett Russian Imperial Stout.
I wasn't too sure what I was going to get out of this beer - I was expecting something along the lines of a dark mild. Instead, I've got something more like the bastard child of a mild and a stout.
Appearance: Black, but if you hold it upto a lights its a deep ruby-red. The head is light-tan in colour, course, and lasts for a few minutes after pouring.
Aroma: A bit of roast and malt. Willamette aroma is present but subtle.
Flavour: The flavour of this beer is deceptively mild given the dark colour. The roast notes are present, but subdued. Even so, they are the dominant flavour. These roast notes are somewhat balanced by a slight maltiness and a bit of hop bitterness. The beer is a little watery and too thin in the body for my liking. Somehow the aftertaste manages to be a mix of sweetness and a subtle lingering hop bitterness - despite an absence of sweetness elsewhere.
Mouthfeel: Thin and watery; no astringency or drying sensation. For a mild this would have been spot-on, but there isn't quite enough to support the darker malts and flavours of this beer.
Overall: I've made far better beers, and far worse beers as well. Given this beer was made using leftover hops from a previous batch and by rinsing the grain bed of a bigger beer, I cannot complain too much. Its easy drinking, and has a pleasant flavour. I don't see myself making this exact beer again, but if I were I'd not change much other than using DME in place of the sugar I added to build the alcohol level.
I wasn't too sure what I was going to get out of this beer - I was expecting something along the lines of a dark mild. Instead, I've got something more like the bastard child of a mild and a stout.
Appearance: Black, but if you hold it upto a lights its a deep ruby-red. The head is light-tan in colour, course, and lasts for a few minutes after pouring.
Aroma: A bit of roast and malt. Willamette aroma is present but subtle.
Flavour: The flavour of this beer is deceptively mild given the dark colour. The roast notes are present, but subdued. Even so, they are the dominant flavour. These roast notes are somewhat balanced by a slight maltiness and a bit of hop bitterness. The beer is a little watery and too thin in the body for my liking. Somehow the aftertaste manages to be a mix of sweetness and a subtle lingering hop bitterness - despite an absence of sweetness elsewhere.
Mouthfeel: Thin and watery; no astringency or drying sensation. For a mild this would have been spot-on, but there isn't quite enough to support the darker malts and flavours of this beer.
Overall: I've made far better beers, and far worse beers as well. Given this beer was made using leftover hops from a previous batch and by rinsing the grain bed of a bigger beer, I cannot complain too much. Its easy drinking, and has a pleasant flavour. I don't see myself making this exact beer again, but if I were I'd not change much other than using DME in place of the sugar I added to build the alcohol level.
Saturday, 13 September 2014
It was a dark and raining morning...Redemption Harvest Ale
I brew a fair number of beers that I don't blog about - basic bitters, pale ales and the like which have nothing special, funky or unusual about them. Crowd-pleasers for BBQs, camping, etc. Today's beer is one of these, but I'm blogging it anyways for two reasons: 1) I feel the need for some redemption after my series of disastrous brews, and 2) I'm doing a harvest (wet-hop) ale, using the last of this years cascade harvest.
It was a bad year for the hops - too wet, too cold (the combination of which destroyed my Goldings), and one Cascade plant got decimated by mites. But, despite that I've got ~8oz of dried cascades in the freezer, and close to that sitting on my drying rack after a very wet morning spent picking hops. I'm planning on putting 250 g (over 8 oz) of wet hops into this beer, but even so, I should have about that much left over - after drying giving another 2.5 or so ounces of dried cascades for the freezer.
The one point I want to make before hitting the fold is how I guesstimated the alpha acids in the wet hops. Wet hops are about 6 parts water and 1 part dry-weight. So the 1% alpha acid number used in the recipe is equal to the average alpha acid content of dried Cascade hops (6%) divided by the wet:dry ratio (6X).
Recipe and notes below the fold.
It was a bad year for the hops - too wet, too cold (the combination of which destroyed my Goldings), and one Cascade plant got decimated by mites. But, despite that I've got ~8oz of dried cascades in the freezer, and close to that sitting on my drying rack after a very wet morning spent picking hops. I'm planning on putting 250 g (over 8 oz) of wet hops into this beer, but even so, I should have about that much left over - after drying giving another 2.5 or so ounces of dried cascades for the freezer.
The one point I want to make before hitting the fold is how I guesstimated the alpha acids in the wet hops. Wet hops are about 6 parts water and 1 part dry-weight. So the 1% alpha acid number used in the recipe is equal to the average alpha acid content of dried Cascade hops (6%) divided by the wet:dry ratio (6X).
Recipe and notes below the fold.
Wednesday, 10 September 2014
One mystery solved...
As I mentioned yesterday I recently developed a persistent infection of part of my brewing setup. Thee batches that passed through my primary fermenter ended up infected (based on aroma/taste/texture); in the final beer I was able to confirm the infection directly by examining a wort sample in which I observed chains of highly elongated rod-shaped bacteria.
Aside from having no idea where the infection came from, I also had no idea what it was. The cell size and length:width ratio were too big for lactobacillus; the shape and formation of chains was inconsistent with both pediococcus and acetobacter. In other words, it isn't likely one of our usual suspects. So I ran a variation of the genomic sequencing method I've used previously to ID yeast, but this time with primers that recognize bacteria - producing the following sequence:
For those who don't read DNA, that the sequence of Bacillus subtilis's ribosome. This explains...well pretty much everything. Bacillus are spore producing species and their spores are very nearly indestructible - they can survive transient exposure to bleach, are pretty much impermeable to sanitizers like starsan, and can even survive short period of boiling! Moreover, their spores stick to surfaces like crazy-glue, making them near-impossible to remove. The persistence of Bacillus spores, but killing of the vegetative (growing) form after sanitation, would lead to the situation I've experienced - stuff fermented briefly in the container appears normal until weeks after packaging, while beers fermented for longer periods show signs while still in the primary.
Of course, the question is where the heck did this come from? B. subtilis grows in the soil, and is a normal components of our guts - so it is comforting to think that it may be nothing more than an environmental contaminant. But I don't think that is the source - at the time I was developing a teaching lab - using B. subtilis - for an undergrad course that I am currently running. I have a sneaking suspicion I may literally have brought my work home with me...
Aside from having no idea where the infection came from, I also had no idea what it was. The cell size and length:width ratio were too big for lactobacillus; the shape and formation of chains was inconsistent with both pediococcus and acetobacter. In other words, it isn't likely one of our usual suspects. So I ran a variation of the genomic sequencing method I've used previously to ID yeast, but this time with primers that recognize bacteria - producing the following sequence:
| AGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGG GAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGA GTGATGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAA TAGGGCGGTACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCC GCGGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGGC GGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGG GGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGTGTAGCGGTGAAATGCGTAGAGA TGTGGAGGAACACCAGTGGCGAAGGCGACTCTCTGGTCTGTAACTGACGCTGAGGAGCGA AAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGC TAAGTGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTCCGCCTG GGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGTGG AGCATGTGGTTTAATTCGAAGCA |
For those who don't read DNA, that the sequence of Bacillus subtilis's ribosome. This explains...well pretty much everything. Bacillus are spore producing species and their spores are very nearly indestructible - they can survive transient exposure to bleach, are pretty much impermeable to sanitizers like starsan, and can even survive short period of boiling! Moreover, their spores stick to surfaces like crazy-glue, making them near-impossible to remove. The persistence of Bacillus spores, but killing of the vegetative (growing) form after sanitation, would lead to the situation I've experienced - stuff fermented briefly in the container appears normal until weeks after packaging, while beers fermented for longer periods show signs while still in the primary.
Of course, the question is where the heck did this come from? B. subtilis grows in the soil, and is a normal components of our guts - so it is comforting to think that it may be nothing more than an environmental contaminant. But I don't think that is the source - at the time I was developing a teaching lab - using B. subtilis - for an undergrad course that I am currently running. I have a sneaking suspicion I may literally have brought my work home with me...
Tuesday, 9 September 2014
If at first you don't succeed, throw everything out and try again!
Its been another bad day - beginning a few months ago with my first dumper in 7 years, due, I thought, to mis-management of the Brett used in that beer. This was followed by an apparently successful cranberry wit, and then my all-Brett Russian Imperial Stout. The stout started off well, but has since taken a turn for the worse - the same chemical/lemon aroma that appeared in my dumper also began to emerge from this beer, along with a horrid solvent/chemical flavour. At the same time the apparently successful wit began to develop a viscous mouth feel and some odd aromas. Despite all of this, the parti-gyled beer pulled off of the second runnings of the stout fermented fine and has turned into a surprisingly good beer. So what went wrong?
I took a sample of the RIS to work and inspected it under a microscope. I forgot to snap an image, but mixed in among the cute "mickey mouse" Bretts were filamentous rod-shaped bacteria - a lot of them. I am unsure of the exact species that the bacteria may be, but regardless, they are unwelcome guests.
The one common link between the contaminated beers, but lacking from the parti-gyle, was the use of the same plastic fermenter. This, despite repeated rounds of cleaning and sanitation is most likely the source of the contamination, meaning I am now the proud new owners of a large plastic bucket with no apparent use...and after a short trip to the LHBS, the owner of a brand-new bucket and siphon for brewing (I chucked the old siphon to be safe).
I hope this solves the issue - but in two weeks when I re-brew the Russian Imperil Stout, I'll be primarying it in glass...the new bucket is going to be broken in this weekend on a wet-hop ale!
I took a sample of the RIS to work and inspected it under a microscope. I forgot to snap an image, but mixed in among the cute "mickey mouse" Bretts were filamentous rod-shaped bacteria - a lot of them. I am unsure of the exact species that the bacteria may be, but regardless, they are unwelcome guests.
The one common link between the contaminated beers, but lacking from the parti-gyle, was the use of the same plastic fermenter. This, despite repeated rounds of cleaning and sanitation is most likely the source of the contamination, meaning I am now the proud new owners of a large plastic bucket with no apparent use...and after a short trip to the LHBS, the owner of a brand-new bucket and siphon for brewing (I chucked the old siphon to be safe).
I hope this solves the issue - but in two weeks when I re-brew the Russian Imperil Stout, I'll be primarying it in glass...the new bucket is going to be broken in this weekend on a wet-hop ale!
Subscribe to:
Posts (Atom)

