Finally, the last video in my "Hunting Wild Yeast" video series is complete. In this, the third and final video, I briefly discuss some of the things you can look for when assessing yeast/bacteria growing on an agar plate, in order to avoid potentially dangerous organisms and to increase your odds of identifying something good.
Both videos are based off of this years wild yeast hunt, whose methodology and results are summarized over two blog posts.
A blog on craft beer, home brewing, and yeast wrangeling
Sui Generis Brewing Has Moved
Sui Generis Brewing has moved to a new website, located at http://www.suigenerisbrewing.com. No additional posts will be made here at blogspot and commenting has been disabled. I encourage you to redirect your RSS feed to the updated feed, and to update your bookmarks.
Thank you for all your support over the past 5 years, and I hope you will join me in my new endeavor, over at http://www.suigenerisbrewing.com
Sunday, 28 December 2014
Friday, 26 December 2014
Book Review: Vintage Beer by Patrick Dawson
Although it may not appear to be the case, I'm actually at the beginning of a series on the brewing (and enjoyment) of vintage beers. This series started nearly two months ago with a post on two well-aged beers I've brewed since starting this blog, and continues today with a review of one of the best beer books I bought this year - Vintage Beer - A Taster's Guide to Brews That Improve over Time by Patrick Dawson.
You'll notice that I said "beer book" not "brewing book", because nowhere in the pages of this book will you find brewing tips or recipes, nor any discussions of bringing commercial-scale processes into the home brewery, nor any discussion relating to home brewing ingredients, scales or methods. Despite this, this is one of the most important home brewing books I've added to my book collection in many years. This book is a must have for any home brewer who brews - or is thinking of brewing - long-aging beers.
Confused? This apparent contradiction is explained below the fold...
Friday, 19 December 2014
A small step...maybe
After a month of bad press the "owner" of our major alcohol distribution system - e.g. the government - finally appears to have noticed that there is a problem. Although whether they perceive the problem as being an unfair system that increases costs while decreasing selection, or merely one of bad press, is yet to be seen.
But at least our Premier, Kathleen Wynn, has said that the system is unfair and "will be changed".
Of course the big brewers are crying like babies, and making up stories about how competition is somehow going to lead to prices going up by ~15%...
But at least our Premier, Kathleen Wynn, has said that the system is unfair and "will be changed".
Of course the big brewers are crying like babies, and making up stories about how competition is somehow going to lead to prices going up by ~15%...
Monday, 15 December 2014
Brett Trois - A riddle, wrapped in a mystery, inside an enigma.
So recently a youtube viewer of mine (Dan Aba, whose youtube channel you need to check out if you haven't already) turned me onto a Facebook group dedicated to sour beers. Lo and behold, the first thread I see on the forum is one claiming that Brettanomyces trois is actually a Saccharomyces yeast! This info didn't just come from nowhere; Lance Shaner of Omega Yeast Labs sent of the strain to a friend for sequencing, and the sequence came back Saccharomyces. Unfortunately, the sequence quality was poor and the sample appears to be a mix of two strains - so I thought it was time to do my own investigation.
The process I followed was fairly straight forward:
The process I followed was fairly straight forward:
- I grew up B. trois from my yeast bank, overnight in a 37oC shaking culture - 1.040 wort + penicillin and streptomycin (to ensure a bacteria-free culture, not because my stocks are dirty)
- I took some images to assess morphology of the yeast
- I isolated some DNA and sequenced the Internal Transcribed Spacer (ITS) and part of the small (18s) rRNA gene to identify the yeast, using an optimized version of what I was doing in my previous posts.
So what did these experiments show? . . . . . . . Answer (and details) below the fold.
Tuesday, 9 December 2014
The Conspiracy - Revealed
This is another of my Ontario-centric rants about beer distribution in my province - so my non-local readers may want to pass this post buy (unless you want to see just how crazy things here are). In Ontario beer is distributed via two government-maintained channels. A government owned/run LCBO chain of stores, and a foreign-owned beer monopoly (the beer store) whose monopoly is maintained via government fiat.
The system is flawed beyond belief; the beer has a secret agreement with the LCBO that gives it a near monopoly on beer sales; the LCBO is limited to some pretty strange rules when it comes to the selling of the beer. And the beer store takes advantage of their position - by using a series of extremely expensive "listing fees" the beer store ensures that small brewers cannot complete with the brewers who own the beers store (InBev, Saporro, Molson-Coors). It costs $77,000 to have the beer store carry a single product in a single format across all their stores. Meaning if a brewery wants to sell the same beer in a 6-pack and 12-pack format, it'll cost them $154,000. Obviously, those fees are deadly to small breweries, and all-but-prevents the distribution of 1-off and seasonal brews that are the lifeblood of most craft brewers. And even with this power, the owners still engage in underhanded marketing to further suppress the craft brewing industry.
The big mystery for beer consumers has been why the LCBO doesn't compete in any meaningful fashion with the beer store. There is no legal limitations that would prevent this, and yet the LCBO limits itself to selling singles and the odd six-pack of beer. In some ways the LCBO is more open to craft brewers - but in place of exhoberant listing fees, the LCBO instead has a series of asinine labelling rules and an excessively slow and convoluted listing process. That aside, the question remains why doesn't the LCBO complete.
The answer has finally been provided by The Star, thanks to a whistleblower. The leaked document shows that the LCBO and beer store have a secret non-competition agreement meant to keep the LCBO from competing with the beer store (with no apparent gain for the LCBO). Indeed, a former head of the LCBO has complained (without revealing details) about how this agreement was forced on the LCBO, apparently by government ministers.
Sounds fishy...if not outright corrupt.
At least now we know why the LCBO doesn't compete with the beer store and offer a meaningful second option to craft brewers. Whether this revelation will mean anything in terms of reform (or even better, outright privatization) is yet to be seen. But at least the agreement is now out there under public scrutiny.
The system is flawed beyond belief; the beer has a secret agreement with the LCBO that gives it a near monopoly on beer sales; the LCBO is limited to some pretty strange rules when it comes to the selling of the beer. And the beer store takes advantage of their position - by using a series of extremely expensive "listing fees" the beer store ensures that small brewers cannot complete with the brewers who own the beers store (InBev, Saporro, Molson-Coors). It costs $77,000 to have the beer store carry a single product in a single format across all their stores. Meaning if a brewery wants to sell the same beer in a 6-pack and 12-pack format, it'll cost them $154,000. Obviously, those fees are deadly to small breweries, and all-but-prevents the distribution of 1-off and seasonal brews that are the lifeblood of most craft brewers. And even with this power, the owners still engage in underhanded marketing to further suppress the craft brewing industry.
The big mystery for beer consumers has been why the LCBO doesn't compete in any meaningful fashion with the beer store. There is no legal limitations that would prevent this, and yet the LCBO limits itself to selling singles and the odd six-pack of beer. In some ways the LCBO is more open to craft brewers - but in place of exhoberant listing fees, the LCBO instead has a series of asinine labelling rules and an excessively slow and convoluted listing process. That aside, the question remains why doesn't the LCBO complete.
The answer has finally been provided by The Star, thanks to a whistleblower. The leaked document shows that the LCBO and beer store have a secret non-competition agreement meant to keep the LCBO from competing with the beer store (with no apparent gain for the LCBO). Indeed, a former head of the LCBO has complained (without revealing details) about how this agreement was forced on the LCBO, apparently by government ministers.
Sounds fishy...if not outright corrupt.
At least now we know why the LCBO doesn't compete with the beer store and offer a meaningful second option to craft brewers. Whether this revelation will mean anything in terms of reform (or even better, outright privatization) is yet to be seen. But at least the agreement is now out there under public scrutiny.
Friday, 5 December 2014
Two New Videos!
Months after filming I've finally completed two videos in a three-part series on collecting & purifying wild yeast. These videos are part of my "Hunting Wild Yeast" series of blog posts, and go hand-in-hand with those posts.
The first video gives a quick overview of two ways to collect wild yeasts - namely, grabbing them off of fruits/veggies/plants/etc and collecting them from the air.
The second video shows a simple method for purifying individual strains of yeast and bacteria, in order to get pure strains for later use.
Both videos are based off of this years wild yeast hunt, whose methodology and results are summarized over two blog posts.
Video 1: Capturing Wild Yeast
Video 2: Purifying Wild Yeast
The first video gives a quick overview of two ways to collect wild yeasts - namely, grabbing them off of fruits/veggies/plants/etc and collecting them from the air.
The second video shows a simple method for purifying individual strains of yeast and bacteria, in order to get pure strains for later use.
Both videos are based off of this years wild yeast hunt, whose methodology and results are summarized over two blog posts.
Video 1: Capturing Wild Yeast
Video 2: Purifying Wild Yeast
Monday, 17 November 2014
Serial Feeding
In my review of "Brewing Engineering" by Steven Deeds I mentioned that I had an issue with a recommendation of his that amounted to using serial feedings to get a single tube of yeast upto pitchable amounts without using a starter. This led to some discussion with Dennis of Life Fermented asking why serial feeding is bad and how it differs from sugar additions in Belgian brewing traditions. I began an answer to this question, and quickly hit the character limit for a comment. So here's the answer in full.
Just to provide a little more background, the procedure the author was recommending was to hold back a portion of your wort, such that you are pitching a tube of white labs/wyeast yeast into an appropriate volume of wort for the cell count. At a later timepoint you then add the remainder of the wort, under the (likely correct) assumption that you now have sufficient yeast for the batch.
The issue with this comes down to a few things - what drives yeast cell division (and thus, production of some off-flavours), how yeasts change to a changing fermentation environment, and how yeast process fermentables.
More below the fold...
Just to provide a little more background, the procedure the author was recommending was to hold back a portion of your wort, such that you are pitching a tube of white labs/wyeast yeast into an appropriate volume of wort for the cell count. At a later timepoint you then add the remainder of the wort, under the (likely correct) assumption that you now have sufficient yeast for the batch.
The issue with this comes down to a few things - what drives yeast cell division (and thus, production of some off-flavours), how yeasts change to a changing fermentation environment, and how yeast process fermentables.
More below the fold...
Friday, 14 November 2014
Documentary - Straight-up: The Issue of Alcohol in Ontario
This video is probably not of much interest to many of my readers. But for those of you in Ontario, its worth the hour of your life needed to go through it.
This video, originally streamed on Mom & Hops, is the product of a kickstarter campaign by Peter Lenardon and A.J. Wykes, and explores the alcohol distribution system here in Ontario and how it is gamed to ensure that new market entrants - e.g. local craft brewers - have the smallest chance of success.
The video features interviews with a number of Ontario brewers, discussing how the existing system which limits their ability to distribute (while not imposing the same limits on the big brewers) negatively impacts their ability to grow, reach their customers, and compete with the big brewers.
This video, originally streamed on Mom & Hops, is the product of a kickstarter campaign by Peter Lenardon and A.J. Wykes, and explores the alcohol distribution system here in Ontario and how it is gamed to ensure that new market entrants - e.g. local craft brewers - have the smallest chance of success.
The video features interviews with a number of Ontario brewers, discussing how the existing system which limits their ability to distribute (while not imposing the same limits on the big brewers) negatively impacts their ability to grow, reach their customers, and compete with the big brewers.
Tuesday, 11 November 2014
Book Review: Brewing Engineering
A two years or so ago I began a series of review articles on the various books in my brewing library. I had meant that to be a continuing series, but somehow it all got away from me and I now find myself with over a years worth of accumulated books and not a single word written about any of them.
I've been nudged out of my reviewing funk by Steven Deeds, author of Brewing Engineering, asking I do a review of the new edition (2nd edition) of his book. Free PDF in hand (yes, my services come cheap) I agreed to embark in my first review in over a year and a half...
Synopsis:
This book takes a very different approach to its audience than most brewing books. One complaint I've made about a number of brewing books is that they aim at a very large audience - often to the detriment of the book. For example, Jamil's book "Yeast" targeted both home & commercial brewers, leaving both with too few details in some places and extraneous details elsewhere. From the point of view of a publisher this approach makes sense - the larger the audience the better the commercial success - but often the reader is left wanting more in some places and less in others. One pleasure of this book is that it is targeted squarely at the experienced home brewer - space is not wasted on "common knowledge" items (terminology, brewing process, ingredient characters, etc), nor is space spent on issue only of interest to commercial brewers with hectolitre tanks.
The data-heads out there will appreciate the more systematic approach to the presentation of graphs & data - e.g. giving R2 values for data fitting - and I really appreciated the mathematical approaches taken in some sections. Most of the time this approach works, but there are some cases where the author assumes a level of knowledge beyond what most experienced home brewers would have, leaving even the target audience (and admittedly, scientists such as myself) a little lost. There are also a few sections that are erroneous, or where the author repeats common misconceptions. But these sections are outweighed by the otherwise great information and unique information found between the pages of this book.
I'd also add that this is the first book to my knowledge which does a detailed analysis and description of brew-in-a-bag, which is an ever more popular way of brewing. Overall this is a good book - but one which you won't want to add to your shelf until you've moved past basic brewing and are moving onto a more advanced and technical approach to your hobby.
As always, more below the fold.
I've been nudged out of my reviewing funk by Steven Deeds, author of Brewing Engineering, asking I do a review of the new edition (2nd edition) of his book. Free PDF in hand (yes, my services come cheap) I agreed to embark in my first review in over a year and a half...
Synopsis:
This book takes a very different approach to its audience than most brewing books. One complaint I've made about a number of brewing books is that they aim at a very large audience - often to the detriment of the book. For example, Jamil's book "Yeast" targeted both home & commercial brewers, leaving both with too few details in some places and extraneous details elsewhere. From the point of view of a publisher this approach makes sense - the larger the audience the better the commercial success - but often the reader is left wanting more in some places and less in others. One pleasure of this book is that it is targeted squarely at the experienced home brewer - space is not wasted on "common knowledge" items (terminology, brewing process, ingredient characters, etc), nor is space spent on issue only of interest to commercial brewers with hectolitre tanks.
The data-heads out there will appreciate the more systematic approach to the presentation of graphs & data - e.g. giving R2 values for data fitting - and I really appreciated the mathematical approaches taken in some sections. Most of the time this approach works, but there are some cases where the author assumes a level of knowledge beyond what most experienced home brewers would have, leaving even the target audience (and admittedly, scientists such as myself) a little lost. There are also a few sections that are erroneous, or where the author repeats common misconceptions. But these sections are outweighed by the otherwise great information and unique information found between the pages of this book.
I'd also add that this is the first book to my knowledge which does a detailed analysis and description of brew-in-a-bag, which is an ever more popular way of brewing. Overall this is a good book - but one which you won't want to add to your shelf until you've moved past basic brewing and are moving onto a more advanced and technical approach to your hobby.
As always, more below the fold.
Sunday, 2 November 2014
A tale of two beers
| This is the first in a series of articles I am working on about deigning, brewing and cellering vintage (long-aging) beers. By long ageing I mean a year minimum, with the upper ceiling ranging upwards of a few decades. This opening post is a bit of my history with vintage beers and an example of two of my more "recent" vintage brews. Future articles will look at how these beers age, how to design and brew them, and culminate with a long-planned recipe and brewday for a beer that I hope I will enjoy for a decade or more. |
I have long enjoyed vintage beers, by which I mean beers aged for years before consumption. My first experience with these beers was an accident. My first barley wine was not conceived under the best of circumstances - I was more interested in the alcohol content than the finer aspects of the style. As was the norm in the 1990's the beer was under-pitched and fermented too warm, leading to a hot and overly estery beer that was unpalatable. Embarrassed, I hid these away in my parents basement where they were out-of-sight. Three or four years later, while helping my parents move, I found the missing cases of beer. On a lark I drank a bottle. In place of the fusel heat and esters were hints of sherry and toffee, dried fruits and wine. And so began a love of vintage beers.
Since that day I've made a point of aging a few bottles of any strong beer (over 8%) to see how they turn out over 8 to 18 months, and once or twice a year brew a batch of beer explicitly for laying down for some long ageing. "Recently" (March and October 2013) I brewed two such batches, and to open my mini-series on vintage beers I thought I would describe how these two particular beers have changed over time.
The beers:
| Gnarly Roots Barley Wine Brewed: March 2013 Age: 1 year, 7 months % Alcohol: 12.8% IBUs: 100 IBU Other: Secondaried with Brett |
42 (Belgian Dark Strong) Brewed: October 2013 Age: 13 months % Alcohol: 8.2% IBUs: 26 IBU Other: Brewed with homemade candi |
Remainder of the post is below the fold...
Thursday, 23 October 2014
Where will you be November 1?
I know for most of my readers the asnwer will be "somewhere a long ways away from you", but for those in the London are (Ontario, not UK), you should by at Forked River Brewery for the annual "Learn To Brew" event. Myself and several other members of the London Homebrewers Guild will be at Forked River Brewing, where we will be brewing beer and showing the public how its done. Several methods of home brewing will be on display - BIAB, several different conventional mashing/lauter system, and so on. We'll be arriving early to set up our kit, with the doors to the brewery opening to the public at 11 AM - so come learn to brew, and take home some tasty craft beer when you are done!
Wednesday, 22 October 2014
Tasting Notes: 2014 Harvest Ale
A month ago I brewed a wet-hop ale using cascade hops I grew in my ya balard and a mix of 2-row, crystal 40 and chocolate malt. A month later and this beer has peaked. So how did it turn out?
Aroma: The cascade notes were not as strong as I expected; in their place is a more generic hop aroma. The normal citrus and resin notes are there, but faint. There is a clear malt note running along side the hops.
Appearance: I forgot to take a picture, but this beer is brown-red; a little darker than I had planned, but the red hue is quite enjoyable. The beer pours with a creamy white head that lasts the whole pint (and well into the second).
Flavour: This beer has a fatal flaw - in my planning of the beer I forgot what I was trying to implement. I like crystal malt character, and so I built a malt base to emphasize that - forgetting the goal was to let the fresh hops be the lead actor. The malt character is fantastic; a creamy beer with sweet crystal notes. But the crystal note is strong enough to hide some of the hop character - in another beer this would be a fantastic malty beer, but its not quite what I wanted. I also overshot the hops; as with the aroma the hop character doesn't scream "cascade", but instead is a mix of more generic hop tones, underlayed by a bit of an astringent vegetal character. I think that vegetal character is a sign that the amounts of hops I added was excessive, meaning next year I may drop 100g or so of the wet hops from the hop bill.
Mouthfeel: This is spot-on. Medium bodied, medium carbonation and smooth on the tongue. Dead-on for any sort of English-style pale ale or stronger bitter, but a bit more malty than the American variants.
Overall: This is a really, really good beer. Malty, good balance of bitterness and maltiness. Eminently drinkable, pint after pint. Aside from the mild vegetal character there isn't much to detract from this beer...except for the fact that the very character I was aiming to emphasize (fresh hop flavours and aromas) have been swamped by an overly aggressive malt bill. The fix here is simple - brew this beer using English hops to make a killer pale ale...and design a different recipe for next years harvest ale.
Aroma: The cascade notes were not as strong as I expected; in their place is a more generic hop aroma. The normal citrus and resin notes are there, but faint. There is a clear malt note running along side the hops.
Appearance: I forgot to take a picture, but this beer is brown-red; a little darker than I had planned, but the red hue is quite enjoyable. The beer pours with a creamy white head that lasts the whole pint (and well into the second).
Flavour: This beer has a fatal flaw - in my planning of the beer I forgot what I was trying to implement. I like crystal malt character, and so I built a malt base to emphasize that - forgetting the goal was to let the fresh hops be the lead actor. The malt character is fantastic; a creamy beer with sweet crystal notes. But the crystal note is strong enough to hide some of the hop character - in another beer this would be a fantastic malty beer, but its not quite what I wanted. I also overshot the hops; as with the aroma the hop character doesn't scream "cascade", but instead is a mix of more generic hop tones, underlayed by a bit of an astringent vegetal character. I think that vegetal character is a sign that the amounts of hops I added was excessive, meaning next year I may drop 100g or so of the wet hops from the hop bill.
Mouthfeel: This is spot-on. Medium bodied, medium carbonation and smooth on the tongue. Dead-on for any sort of English-style pale ale or stronger bitter, but a bit more malty than the American variants.
Overall: This is a really, really good beer. Malty, good balance of bitterness and maltiness. Eminently drinkable, pint after pint. Aside from the mild vegetal character there isn't much to detract from this beer...except for the fact that the very character I was aiming to emphasize (fresh hop flavours and aromas) have been swamped by an overly aggressive malt bill. The fix here is simple - brew this beer using English hops to make a killer pale ale...and design a different recipe for next years harvest ale.
Tuesday, 21 October 2014
Upgrading a Costco Kegorator
![]() |
| A gas manifold greatly aids in controlling CO2 flow to your kegs. But wait...why a 3-way manifold? |
![]() |
| Of course, no kegorator would be complete with some custom tap handles. |
Saturday, 18 October 2014
Thor's Hammer - Norse Porter
Todays brew is a blast from the past - a recipe which I developed way back in 1998, and which was my most brewed beer (or, at least, base-recipe) for the better part of 10 years. This beer goes back even farther - in the early 90's there wasn't much of a craft beer scene in Western Canada, but this one beer store used to bring in the odd European beer. There was this porter, from Norway, they'd bring in a couple of times a year - the name was unpronounceable (and long since forgotten), but it was good. In fact, it was the beer that started my love-affair with the porter style. Through a lot of trial-and-error (this was before there were many good online brewing resources) a friend and I managed to make a fairly respectable clone of the beer...but could never get it just right. We knew it was a baltic-style porter, and we did everything we could to learn about the style to find our error. One day a chance encounter with a Norwegian brewer online solved our problem - unlike most baltics, this brewery used an ale yeast instead of a lager yeast. Vola - the next batch was spot-on.
From there this brew evolved a lot - substituting English for noble hops, removing the darker malts, brewing an all-Munich/Vienna base malt version and the addition of cherries were all tested at one point or another - and each produced a fantastic beer.
Todays brew goes back to the first "eureka - we got it" recipe; the closest to cloning that one great beer that brought light to an otherwise fairly dark beer-decade.
EDIT: forgot to add, this brew makes use of the Nøgne Ø yeast, kindly provided by Sam of Eureka brewing (also, yeast #113, my commercial yeast bank). Historically I used the old wyeast Scandinavian ale yeast - which apparently was just goold ol' ringwood...
Recipe below the fold.
From there this brew evolved a lot - substituting English for noble hops, removing the darker malts, brewing an all-Munich/Vienna base malt version and the addition of cherries were all tested at one point or another - and each produced a fantastic beer.
Todays brew goes back to the first "eureka - we got it" recipe; the closest to cloning that one great beer that brought light to an otherwise fairly dark beer-decade.
EDIT: forgot to add, this brew makes use of the Nøgne Ø yeast, kindly provided by Sam of Eureka brewing (also, yeast #113, my commercial yeast bank). Historically I used the old wyeast Scandinavian ale yeast - which apparently was just goold ol' ringwood...
Recipe below the fold.
Sunday, 5 October 2014
Its Cider Time!
![]() |
| A third of this years cider haul |
This year I am brewing 15 gal of cider, using three different recipes. The first is the same cider I brewed last year - simple, quick and fantastic. The second batch is an apple wine, its constitution girded with frozen apple juice concentrate and table sugar. The last is a brew for my wife - a wine/cider mix which will be stabilized & back-sweetened once fermentation & aging is complete.
![]() |
L->R: Apple wine, Cider-Grape Cooler, Imperium Brettania
Front: Classical cider
|
Friday, 26 September 2014
Announcing a New Yeast Bank! & A successful Yeast Hunt
As readers of my bank know, I have an interest in wild brews and purifying wild yeasts. I have gone through a series of wild yeast collection attempts, and finally have some success to report (more on that below the fold). In addition, over the past few years I've acquired wild yeasts harvested by other brewers - including the infamous/famous Brettanomyces strains from DCYeast.
I'm splitting off the wild yeasts from my yeast bank of commercial (e.g. Wyeast/White labs/bottle cultured) yeasts. I realize this is a somewhat artificial division, as within the commercial yeasts are yeasts that breweries harvested from the wild, but regardless, I figured this was the best division. The new bank of yeast is still rather small, but it should grow quickly as I purify strains from some successful wild brews I have recently conducted (again, more below the fold). For those of you who like my yeast-culturing videos, you'll be happy to know that I'm using this year's wild-yeast hunt to prepare a video covering the process of isolating pure strains of wild-yeast from beginning-to-end, so watch out for that - it should be up soon.
My "vision" for the wild yeast bank is akin to that of Bootleg Biology, namely a terroir-style project, but in my case the goal is to gather these largely from Canada (although I'm happy to bank wild yeasts from any terroir).
I'm splitting off the wild yeasts from my yeast bank of commercial (e.g. Wyeast/White labs/bottle cultured) yeasts. I realize this is a somewhat artificial division, as within the commercial yeasts are yeasts that breweries harvested from the wild, but regardless, I figured this was the best division. The new bank of yeast is still rather small, but it should grow quickly as I purify strains from some successful wild brews I have recently conducted (again, more below the fold). For those of you who like my yeast-culturing videos, you'll be happy to know that I'm using this year's wild-yeast hunt to prepare a video covering the process of isolating pure strains of wild-yeast from beginning-to-end, so watch out for that - it should be up soon.
My "vision" for the wild yeast bank is akin to that of Bootleg Biology, namely a terroir-style project, but in my case the goal is to gather these largely from Canada (although I'm happy to bank wild yeasts from any terroir).
Monday, 22 September 2014
A Post Worth Reading
I don't often promote other bloggers posts - which is something I need to fix - so to get that ball rolling I'd like to link everyone to this blog post over at Ben's Beer Blog: Labatt is planning an expensive, intentionally misleading ad campaign for Shock Top.
The blog post is essentially a break-down of Labatt's (a subsidiary of In-Bev, which also owns Budweiser) strategy to mislead customers into thinking some of Labatts products are craft beers. It highlights some of the underhanded methods used by "big beer" to squash their craft brewer competition (that's the bad news). The good news is that it also shows just how damaging craft brewing is becoming to the big guys.
The blog post is essentially a break-down of Labatt's (a subsidiary of In-Bev, which also owns Budweiser) strategy to mislead customers into thinking some of Labatts products are craft beers. It highlights some of the underhanded methods used by "big beer" to squash their craft brewer competition (that's the bad news). The good news is that it also shows just how damaging craft brewing is becoming to the big guys.
Sunday, 21 September 2014
Is this beer cursed?
![]() |
| One full mashtun! |
But, as the title suggests, things have not gone well. This time the problem is something else - I usually condition my grain prior to milling. I find that this greatly reduces the risk of a stuck sparge without hurting my efficiency. Not so this time - my efficiency is down 10%, and I'm pretty sure its because I lost track of how much water I conditioned with and thus over-did it.
To help fix this I collected a few extra litres of run-off and am extending my boil time slightly. But even so, I'm not getting the 9% beer I was hoping for, and instead it will be kicking around 7%.
I need a victory - I think my next beer needs to be something simple, something beyond even my ability to screw up. Malt-extract and hops, here I come
Sunday, 14 September 2014
Tasting Notes: 50,002
Although I've been plagued with a series of infected brews lately, I have managed to prepare one brew during the infection-fest. My 50,002 was a partigyle'd beer brewed off of my (unfortunately infected) all-brett Russian Imperial Stout.
I wasn't too sure what I was going to get out of this beer - I was expecting something along the lines of a dark mild. Instead, I've got something more like the bastard child of a mild and a stout.
Appearance: Black, but if you hold it upto a lights its a deep ruby-red. The head is light-tan in colour, course, and lasts for a few minutes after pouring.
Aroma: A bit of roast and malt. Willamette aroma is present but subtle.
Flavour: The flavour of this beer is deceptively mild given the dark colour. The roast notes are present, but subdued. Even so, they are the dominant flavour. These roast notes are somewhat balanced by a slight maltiness and a bit of hop bitterness. The beer is a little watery and too thin in the body for my liking. Somehow the aftertaste manages to be a mix of sweetness and a subtle lingering hop bitterness - despite an absence of sweetness elsewhere.
Mouthfeel: Thin and watery; no astringency or drying sensation. For a mild this would have been spot-on, but there isn't quite enough to support the darker malts and flavours of this beer.
Overall: I've made far better beers, and far worse beers as well. Given this beer was made using leftover hops from a previous batch and by rinsing the grain bed of a bigger beer, I cannot complain too much. Its easy drinking, and has a pleasant flavour. I don't see myself making this exact beer again, but if I were I'd not change much other than using DME in place of the sugar I added to build the alcohol level.
I wasn't too sure what I was going to get out of this beer - I was expecting something along the lines of a dark mild. Instead, I've got something more like the bastard child of a mild and a stout.
Appearance: Black, but if you hold it upto a lights its a deep ruby-red. The head is light-tan in colour, course, and lasts for a few minutes after pouring.
Aroma: A bit of roast and malt. Willamette aroma is present but subtle.
Flavour: The flavour of this beer is deceptively mild given the dark colour. The roast notes are present, but subdued. Even so, they are the dominant flavour. These roast notes are somewhat balanced by a slight maltiness and a bit of hop bitterness. The beer is a little watery and too thin in the body for my liking. Somehow the aftertaste manages to be a mix of sweetness and a subtle lingering hop bitterness - despite an absence of sweetness elsewhere.
Mouthfeel: Thin and watery; no astringency or drying sensation. For a mild this would have been spot-on, but there isn't quite enough to support the darker malts and flavours of this beer.
Overall: I've made far better beers, and far worse beers as well. Given this beer was made using leftover hops from a previous batch and by rinsing the grain bed of a bigger beer, I cannot complain too much. Its easy drinking, and has a pleasant flavour. I don't see myself making this exact beer again, but if I were I'd not change much other than using DME in place of the sugar I added to build the alcohol level.
Saturday, 13 September 2014
It was a dark and raining morning...Redemption Harvest Ale
I brew a fair number of beers that I don't blog about - basic bitters, pale ales and the like which have nothing special, funky or unusual about them. Crowd-pleasers for BBQs, camping, etc. Today's beer is one of these, but I'm blogging it anyways for two reasons: 1) I feel the need for some redemption after my series of disastrous brews, and 2) I'm doing a harvest (wet-hop) ale, using the last of this years cascade harvest.
It was a bad year for the hops - too wet, too cold (the combination of which destroyed my Goldings), and one Cascade plant got decimated by mites. But, despite that I've got ~8oz of dried cascades in the freezer, and close to that sitting on my drying rack after a very wet morning spent picking hops. I'm planning on putting 250 g (over 8 oz) of wet hops into this beer, but even so, I should have about that much left over - after drying giving another 2.5 or so ounces of dried cascades for the freezer.
The one point I want to make before hitting the fold is how I guesstimated the alpha acids in the wet hops. Wet hops are about 6 parts water and 1 part dry-weight. So the 1% alpha acid number used in the recipe is equal to the average alpha acid content of dried Cascade hops (6%) divided by the wet:dry ratio (6X).
Recipe and notes below the fold.
It was a bad year for the hops - too wet, too cold (the combination of which destroyed my Goldings), and one Cascade plant got decimated by mites. But, despite that I've got ~8oz of dried cascades in the freezer, and close to that sitting on my drying rack after a very wet morning spent picking hops. I'm planning on putting 250 g (over 8 oz) of wet hops into this beer, but even so, I should have about that much left over - after drying giving another 2.5 or so ounces of dried cascades for the freezer.
The one point I want to make before hitting the fold is how I guesstimated the alpha acids in the wet hops. Wet hops are about 6 parts water and 1 part dry-weight. So the 1% alpha acid number used in the recipe is equal to the average alpha acid content of dried Cascade hops (6%) divided by the wet:dry ratio (6X).
Recipe and notes below the fold.
Wednesday, 10 September 2014
One mystery solved...
As I mentioned yesterday I recently developed a persistent infection of part of my brewing setup. Thee batches that passed through my primary fermenter ended up infected (based on aroma/taste/texture); in the final beer I was able to confirm the infection directly by examining a wort sample in which I observed chains of highly elongated rod-shaped bacteria.
Aside from having no idea where the infection came from, I also had no idea what it was. The cell size and length:width ratio were too big for lactobacillus; the shape and formation of chains was inconsistent with both pediococcus and acetobacter. In other words, it isn't likely one of our usual suspects. So I ran a variation of the genomic sequencing method I've used previously to ID yeast, but this time with primers that recognize bacteria - producing the following sequence:
For those who don't read DNA, that the sequence of Bacillus subtilis's ribosome. This explains...well pretty much everything. Bacillus are spore producing species and their spores are very nearly indestructible - they can survive transient exposure to bleach, are pretty much impermeable to sanitizers like starsan, and can even survive short period of boiling! Moreover, their spores stick to surfaces like crazy-glue, making them near-impossible to remove. The persistence of Bacillus spores, but killing of the vegetative (growing) form after sanitation, would lead to the situation I've experienced - stuff fermented briefly in the container appears normal until weeks after packaging, while beers fermented for longer periods show signs while still in the primary.
Of course, the question is where the heck did this come from? B. subtilis grows in the soil, and is a normal components of our guts - so it is comforting to think that it may be nothing more than an environmental contaminant. But I don't think that is the source - at the time I was developing a teaching lab - using B. subtilis - for an undergrad course that I am currently running. I have a sneaking suspicion I may literally have brought my work home with me...
Aside from having no idea where the infection came from, I also had no idea what it was. The cell size and length:width ratio were too big for lactobacillus; the shape and formation of chains was inconsistent with both pediococcus and acetobacter. In other words, it isn't likely one of our usual suspects. So I ran a variation of the genomic sequencing method I've used previously to ID yeast, but this time with primers that recognize bacteria - producing the following sequence:
| AGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGG GAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGA GTGATGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAA TAGGGCGGTACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCC GCGGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGGC GGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGG GGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGTGTAGCGGTGAAATGCGTAGAGA TGTGGAGGAACACCAGTGGCGAAGGCGACTCTCTGGTCTGTAACTGACGCTGAGGAGCGA AAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGC TAAGTGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTCCGCCTG GGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGTGG AGCATGTGGTTTAATTCGAAGCA |
For those who don't read DNA, that the sequence of Bacillus subtilis's ribosome. This explains...well pretty much everything. Bacillus are spore producing species and their spores are very nearly indestructible - they can survive transient exposure to bleach, are pretty much impermeable to sanitizers like starsan, and can even survive short period of boiling! Moreover, their spores stick to surfaces like crazy-glue, making them near-impossible to remove. The persistence of Bacillus spores, but killing of the vegetative (growing) form after sanitation, would lead to the situation I've experienced - stuff fermented briefly in the container appears normal until weeks after packaging, while beers fermented for longer periods show signs while still in the primary.
Of course, the question is where the heck did this come from? B. subtilis grows in the soil, and is a normal components of our guts - so it is comforting to think that it may be nothing more than an environmental contaminant. But I don't think that is the source - at the time I was developing a teaching lab - using B. subtilis - for an undergrad course that I am currently running. I have a sneaking suspicion I may literally have brought my work home with me...
Tuesday, 9 September 2014
If at first you don't succeed, throw everything out and try again!
Its been another bad day - beginning a few months ago with my first dumper in 7 years, due, I thought, to mis-management of the Brett used in that beer. This was followed by an apparently successful cranberry wit, and then my all-Brett Russian Imperial Stout. The stout started off well, but has since taken a turn for the worse - the same chemical/lemon aroma that appeared in my dumper also began to emerge from this beer, along with a horrid solvent/chemical flavour. At the same time the apparently successful wit began to develop a viscous mouth feel and some odd aromas. Despite all of this, the parti-gyled beer pulled off of the second runnings of the stout fermented fine and has turned into a surprisingly good beer. So what went wrong?
I took a sample of the RIS to work and inspected it under a microscope. I forgot to snap an image, but mixed in among the cute "mickey mouse" Bretts were filamentous rod-shaped bacteria - a lot of them. I am unsure of the exact species that the bacteria may be, but regardless, they are unwelcome guests.
The one common link between the contaminated beers, but lacking from the parti-gyle, was the use of the same plastic fermenter. This, despite repeated rounds of cleaning and sanitation is most likely the source of the contamination, meaning I am now the proud new owners of a large plastic bucket with no apparent use...and after a short trip to the LHBS, the owner of a brand-new bucket and siphon for brewing (I chucked the old siphon to be safe).
I hope this solves the issue - but in two weeks when I re-brew the Russian Imperil Stout, I'll be primarying it in glass...the new bucket is going to be broken in this weekend on a wet-hop ale!
I took a sample of the RIS to work and inspected it under a microscope. I forgot to snap an image, but mixed in among the cute "mickey mouse" Bretts were filamentous rod-shaped bacteria - a lot of them. I am unsure of the exact species that the bacteria may be, but regardless, they are unwelcome guests.
The one common link between the contaminated beers, but lacking from the parti-gyle, was the use of the same plastic fermenter. This, despite repeated rounds of cleaning and sanitation is most likely the source of the contamination, meaning I am now the proud new owners of a large plastic bucket with no apparent use...and after a short trip to the LHBS, the owner of a brand-new bucket and siphon for brewing (I chucked the old siphon to be safe).
I hope this solves the issue - but in two weeks when I re-brew the Russian Imperil Stout, I'll be primarying it in glass...the new bucket is going to be broken in this weekend on a wet-hop ale!
Friday, 29 August 2014
Got Brett?
![]() |
| Wyeast 5526 (Brettanomyces lambicus) fermenting my all-brett Russian Imperial Stout Imperium Brettania |
![]() |
| A thing of beauty |
Saturday, 16 August 2014
Double-Header Brew Day!
Believe it or not, it is already time to start the Christmas beer! This years brew - Imperium Brettania - is an inky-black 100% Brettanomyces lambicus fermented Russian Imperial Stout, aged on French oak. Yep, those of you on my xmas exchange list have something to look forward to!
As with my other all-brett dark beers I've made efforts to reduce the amount of grain-derived phenols, in order to limit the production of unpleasant levels of 4-ethylpheol (burnt plastic) and other potentially unpleasant phenols by replacing half of the dark malts with their de-husked equivalents (i.e. carafa special II and III in place of some of the black and chocolate malts). This is combined with a lower-end hop schedule (BU:GU of 0.66), which I hope will keep things balanced once the Brett drys out the beer. This is topped off with a cherry-flavour producing yeast (B. lambicus, Wyeast 5526). This is about as big a beer as I can brew - the 11kg of malt plus 28L of water fills my mash-tun to the lid!
The downside of brewing all-grain big beers like this is that your efficiency usually sucks - its not unheard of for 30% of the fermentables to remain trapped in the mash-tun. I'm fixing this by partigyling this batch - once I've collected the first runnings (Imperium Brettania), I'm doing a second sparge to gather the residual sugars, after which I'm going to hop the runnings with some Willamette hops left over from an older batch, and if needed I'll add a bit of sugar to up the gravity and dry the beer out. I'm not certain what this is going to yield - a sessionable stout, or perhaps a summer mild? Either way, its being named 50,002. Why you ask? That's how many views this blog has recieved as of this morning!
Recipe and notes below the fold.
As with my other all-brett dark beers I've made efforts to reduce the amount of grain-derived phenols, in order to limit the production of unpleasant levels of 4-ethylpheol (burnt plastic) and other potentially unpleasant phenols by replacing half of the dark malts with their de-husked equivalents (i.e. carafa special II and III in place of some of the black and chocolate malts). This is combined with a lower-end hop schedule (BU:GU of 0.66), which I hope will keep things balanced once the Brett drys out the beer. This is topped off with a cherry-flavour producing yeast (B. lambicus, Wyeast 5526). This is about as big a beer as I can brew - the 11kg of malt plus 28L of water fills my mash-tun to the lid!
The downside of brewing all-grain big beers like this is that your efficiency usually sucks - its not unheard of for 30% of the fermentables to remain trapped in the mash-tun. I'm fixing this by partigyling this batch - once I've collected the first runnings (Imperium Brettania), I'm doing a second sparge to gather the residual sugars, after which I'm going to hop the runnings with some Willamette hops left over from an older batch, and if needed I'll add a bit of sugar to up the gravity and dry the beer out. I'm not certain what this is going to yield - a sessionable stout, or perhaps a summer mild? Either way, its being named 50,002. Why you ask? That's how many views this blog has recieved as of this morning!
Recipe and notes below the fold.
Wednesday, 13 August 2014
Pink Beer
So the Cranberry Wit is done and kegged - after 10 days in the primary, and 14 days on 600g of frozen/crushed cranberries. Its hard to capture in a picture, but this beer is pink. Even the head has a hint of pink!
This beer did not turn out as I was expecting, based on the cranberry beers I have tried and read about. I was expecting that astringent flavour that only cranberries create, without much additional berry character - indeed, that seems to be the dominant flavour I've experienced in other cranberry beers. That is present in this beer, but its mild and in the background. I'm not sure if its the yeast or the cranberries, but there is a notable berry note to the flavour.
Quite to my happiness, I did not make the beer I was expecting - I made something better!
Appearance: Pink-toned beer with a light pink head. The head retention is not as good as I'd normally expect of a wheat beer, but I suspect this may be due to the cranberries (cranberry seeds have a lot of oil).
Aroma: Bready, like a wheat beer should be. A lot of fruity notes - whether from the yeast or the cranberries I cannot say.
Flavour: Front of the sip is your typical wheat-beer breadiness layered with fruity flavours. There is a bit of a sweetness to the beer as well. This fades into the typical cranberry astringency, with the sweetness coming out a little more. The aftertaste is a mild cranberry astringency and a fair bit of fruitiness. Hop bitterness and flavour is present, but in the background.
Mouthfeel: This is a very refreshing beer - it whets the mouth and the astringency of the cranberry acting more to balance the whetting sweetness then it acts to dry the mouth. The body is a little thin for a wheat beer - perhaps due to my use of an overnight mash - but works well with the otherwise very refreshing character of this beer.
Overall: This has not been one of my better summers of brewing - I had my first dumper in nearly a decade, my brewing output is less than half of normal, I have a sour solera project planned that I just cannot get off the ground, and if that wasn't enough - the weather this summer has been shit. This beer makes up for all of that - better tasting than planned, and perfect for the odd day when we actually get a bit of sun. This beer is definetly going into the rebrew pile! If I could change one thing it would be...nothing!
This beer did not turn out as I was expecting, based on the cranberry beers I have tried and read about. I was expecting that astringent flavour that only cranberries create, without much additional berry character - indeed, that seems to be the dominant flavour I've experienced in other cranberry beers. That is present in this beer, but its mild and in the background. I'm not sure if its the yeast or the cranberries, but there is a notable berry note to the flavour.
Quite to my happiness, I did not make the beer I was expecting - I made something better!
Appearance: Pink-toned beer with a light pink head. The head retention is not as good as I'd normally expect of a wheat beer, but I suspect this may be due to the cranberries (cranberry seeds have a lot of oil).
Aroma: Bready, like a wheat beer should be. A lot of fruity notes - whether from the yeast or the cranberries I cannot say.
Flavour: Front of the sip is your typical wheat-beer breadiness layered with fruity flavours. There is a bit of a sweetness to the beer as well. This fades into the typical cranberry astringency, with the sweetness coming out a little more. The aftertaste is a mild cranberry astringency and a fair bit of fruitiness. Hop bitterness and flavour is present, but in the background.
Mouthfeel: This is a very refreshing beer - it whets the mouth and the astringency of the cranberry acting more to balance the whetting sweetness then it acts to dry the mouth. The body is a little thin for a wheat beer - perhaps due to my use of an overnight mash - but works well with the otherwise very refreshing character of this beer.
Overall: This has not been one of my better summers of brewing - I had my first dumper in nearly a decade, my brewing output is less than half of normal, I have a sour solera project planned that I just cannot get off the ground, and if that wasn't enough - the weather this summer has been shit. This beer makes up for all of that - better tasting than planned, and perfect for the odd day when we actually get a bit of sun. This beer is definetly going into the rebrew pile! If I could change one thing it would be...nothing!
Friday, 8 August 2014
Your Home Yeast Lab Made Easy - Streak Plates
The fourth of my "Your Home Yeast Lab Made Easy" series is now up on youtube. This video covers an advanced topic - streak plating. I was not planing on covering this topic so early in my video series, but I was streaking yeast for another project and decided to take advantage of the situation.
Streak plating is used any time you need to purify a strain of yeast (or other microorganism). This method allows you to pull single, genetically pure strains of a microorganism out of a mixed culture. This mixed culture could be any number of sources - an old strain of yeast whose characteristics are starting to drift, a contaminated batch of yeast, a mixed culture (e.g. those made by Wyeast, or from a bottle of sour beer), or even from a wild ferment you started using yeast from your back yard!
The principal of streak plating is simple - a small amount of the source yeast is spread across an edge of a petri dish. The yeast/bacteria/etc concentration in this streak are at a high density, so you swipe a sterilized loop across the first set of streaks, picking up a small number of the organisms, and then streak over another portion of the plate. You repeat this two more times, each time diluting out the yeast/etc further.
Streak plating is used any time you need to purify a strain of yeast (or other microorganism). This method allows you to pull single, genetically pure strains of a microorganism out of a mixed culture. This mixed culture could be any number of sources - an old strain of yeast whose characteristics are starting to drift, a contaminated batch of yeast, a mixed culture (e.g. those made by Wyeast, or from a bottle of sour beer), or even from a wild ferment you started using yeast from your back yard!
The principal of streak plating is simple - a small amount of the source yeast is spread across an edge of a petri dish. The yeast/bacteria/etc concentration in this streak are at a high density, so you swipe a sterilized loop across the first set of streaks, picking up a small number of the organisms, and then streak over another portion of the plate. You repeat this two more times, each time diluting out the yeast/etc further.
Thursday, 7 August 2014
Your Home Yeast Made Easy - Aseptic Techniques
The third of my "Your Home Yeast Lab Made Easy" series is now up on youtube! This video is the most important video I will produce as part of this series. The skills I discuss in this video are central to keeping yeast samples uncontaminated - are key and indispensable skill for any brewer interested in taking their yeast culturing activities beyond making starters and washing yeast. You must master these skills if you want to slant or freeze yeast, purify yeast strains, or engage in any form of advanced yeast culturing. In the world of yeast culture, these skills are the your tricycle - until you learn to "ride" these techniques you are not ready to ride the two-wheeler.
I've been trying to keep these video's short, and broke that rule with this one, but the length is for a good reason - these skills are critical for any intermediary or advanced yeast-culturing method, and a 5 minute video simply cannot do this topic justice.
I know my video's are not everyone's cup of tea, so here are some other good resources for those needing additional information, or who get put to sleep by me droning on for 10 minutes...
I've been trying to keep these video's short, and broke that rule with this one, but the length is for a good reason - these skills are critical for any intermediary or advanced yeast-culturing method, and a 5 minute video simply cannot do this topic justice.
I know my video's are not everyone's cup of tea, so here are some other good resources for those needing additional information, or who get put to sleep by me droning on for 10 minutes...
Saturday, 19 July 2014
Your Home Yeast Lab Made Easy - DIY Alcohol Lamp
The second video in my Your Home Yeast Lab Made Easy video series is on how to build and use an alcohol lamp - a key piece of equipment required for any home yeast lab.
One of the most important tools for any yeast or bacterial culturing lab is a powerful flame source. Traditionally, scientists have used a Bunsen burner, but these tools are expensive and can be unsafe in the home environment. A safer (and cheaper) alternative is the alcohol lamp. Like a Bunsen burner, these lamps generate a flow of air which provides you with a clean space that is relatively protected from contaminants in which you can open yeast samples, tubes of fresh petri dishes, and so forth. In addition, the flame itself can be used to sterilize some of the equipment used for yeast culturing. This is a must-have tool for the home yeast lab!
One of the most important tools for any yeast or bacterial culturing lab is a powerful flame source. Traditionally, scientists have used a Bunsen burner, but these tools are expensive and can be unsafe in the home environment. A safer (and cheaper) alternative is the alcohol lamp. Like a Bunsen burner, these lamps generate a flow of air which provides you with a clean space that is relatively protected from contaminants in which you can open yeast samples, tubes of fresh petri dishes, and so forth. In addition, the flame itself can be used to sterilize some of the equipment used for yeast culturing. This is a must-have tool for the home yeast lab!
New Video: Your Home Yeast Lab Made Easy
I've been asked many times here on my blog, on my YouTube channel, and in person, to do some videos and posts about how to employ some of the methods I use in my lab to culture yeast in the home. I've long been promising to prepare videos that do just that, and today I begin making good on that promise!
This is the first video in a planned series of 9 or 10 videos. The goal is to keep the videos short as to give the information in easily-digestible bites. This first video shows you how to set-up a workspace in your home for yeast culturing.
At this time I have video filmed for two additional episodes - how to make an alcohol lamp (a DIY Bunsen burner), and how to do a streak plate. Watch for these over the next few days! Future videos will include:
This is the first video in a planned series of 9 or 10 videos. The goal is to keep the videos short as to give the information in easily-digestible bites. This first video shows you how to set-up a workspace in your home for yeast culturing.
At this time I have video filmed for two additional episodes - how to make an alcohol lamp (a DIY Bunsen burner), and how to do a streak plate. Watch for these over the next few days! Future videos will include:
- Basic sterile techniques
- Preparation of starters
- Preparation & use of agar plates in the home lab
- Preparation & use of slants in the home lab
- Freezing yeast at home
- Purifying wild yeast
Tuesday, 15 July 2014
The tartness of his face sours ripe grapes.
Instead of weeping when a tragedy
occurs in a songbird's life, it sings
away its grief. I believe we could
well follow the pattern of our
feathered friends.
--Shakespeare
I'm quoting Shakespearean tragedies - clearly something has gone wrong. If the melancholy intro didn't give that away, the picture to the right should - that's a full keg of beer going down the drain. Specifically my Easy as 1-2-3-4: a Rye Berliner Weiss...
...clearly it wasn't as easy as I intended. So where did things go wrong?
The short answer is "I don't know", simply because I threw so many new things into this batch that its not possible to point the finger at a likely culprit. I'm 99% sure the problem was the ratio's of the yeast I threw in. Two of the three yeasts - both brett - were reputed to have a lemony character, and combined were half the yeast I pitched. Their lemony character was present in this beer - in spades. The lemon was so intense it was "chemical" in character; more in-place in a bottle of furniture polish than a beer. In addition there was a strong acetaldehyde/nail polish note - perhaps due to the use of a pure lacto culture, or perhaps again due to the yeast used. Moreover, the yeast wouldn't settle (even after a cold-crash), leaving the beer hazy and with a strong yeast character.
I shouldn't complain too much - this is the first dumper in over 7 years...& that ain't bad.
occurs in a songbird's life, it sings
away its grief. I believe we could
well follow the pattern of our
feathered friends.
--Shakespeare
I'm quoting Shakespearean tragedies - clearly something has gone wrong. If the melancholy intro didn't give that away, the picture to the right should - that's a full keg of beer going down the drain. Specifically my Easy as 1-2-3-4: a Rye Berliner Weiss...
...clearly it wasn't as easy as I intended. So where did things go wrong?
The short answer is "I don't know", simply because I threw so many new things into this batch that its not possible to point the finger at a likely culprit. I'm 99% sure the problem was the ratio's of the yeast I threw in. Two of the three yeasts - both brett - were reputed to have a lemony character, and combined were half the yeast I pitched. Their lemony character was present in this beer - in spades. The lemon was so intense it was "chemical" in character; more in-place in a bottle of furniture polish than a beer. In addition there was a strong acetaldehyde/nail polish note - perhaps due to the use of a pure lacto culture, or perhaps again due to the yeast used. Moreover, the yeast wouldn't settle (even after a cold-crash), leaving the beer hazy and with a strong yeast character.
I shouldn't complain too much - this is the first dumper in over 7 years...& that ain't bad.
Saturday, 12 July 2014
2014 Wild Yeast Hunt
![]() |
| This years sources of wild yeast, waiting for wort. L->R: Clover, Chokecherries, Raspberry, Tomato, Blueberry, Young hop (goldings) |
While the first hunt didn't turn out as well as I had hoped, it did serve to get a lot of groundwork established. I now have a tried and tested method of identifying yeasts using DNA sequencing (posts 1, 2, 3 and 4), as well as my purification methods down pat...so its time for the 2014 hunt!
This years strategy is a little different. I'm stealing some wort from my Ephemeral Cranberry Wit, and am inoculating it using various yeast sources from around the yard. My wife runs one hell of a garden, and form there I'm taking yeast from some raspberries, blueberries, tomatoes, and strawberries. In addition, we've got some hops, choke-cherries and wild clover growing in the back, so I'm going to harvest from those as well. Each fruit/veg (OK, technically they're all fruits but the clover & hops - which are neither fruit nor veg) will be dropped into ~25ml of freshly brewed wort and allowed to ferment out for at least a month.
After the month is up I'll do my first harvest of yeast, plate them out, and see what I find. Every month or so thereafter I'll repeat the harvest. Interesting yeast will be kept frozen and eventually subjected to fermentation tests to see how well they work, and how well they taste. I'm also going to harvest the end-product of the ferments (at about 6 months) as mixed cultures, potentially for use in some sour beers down the road.
I'll add more posts as we go, but to finish here's some semi-artsy shots of the yeast sources.
![]() |
| Clover |
![]() |
| SWIMBO's garden |
Brew Day: Ephemeral Cranberry Wit
Its time for another summer brew - this time a Wit brewed with cranberries. This recipe is formulated roughly along the lines of Unibroue's Éphémère Cranberry, although in no way is this a clone. If you haven't had this beer, you should try it - its fantastic! My recipe is aiming to achieve a similar beer, but is far from a clone. In fact, its essentially a leftovers beer - i.e. its been formulated as best as I can manage based on the grains & hops & yeast I have on hand.
In addition, I'm trying a split brew-day, where I'm mashing in late at night on Friday and then getting up at 6AM Saturday morning to finish the brew (not my choice - SWIMBO planned family events without mentioning them to me). I'm looking forward to seeing how well the split brew session works, because it may get me brewing more than my current busy schedule allows.
Recipe and brew-days notes below the fold.
In addition, I'm trying a split brew-day, where I'm mashing in late at night on Friday and then getting up at 6AM Saturday morning to finish the brew (not my choice - SWIMBO planned family events without mentioning them to me). I'm looking forward to seeing how well the split brew session works, because it may get me brewing more than my current busy schedule allows.
Recipe and brew-days notes below the fold.
Tuesday, 8 July 2014
Tasting Notes: Shipwrecked Saison
I've been drinking this one for a while, so its time for a review. I brewed this beer a month or so ago, with the beer fermenting while I was away on holiday. This meant my fermentation strategy was "the upcoming weathers temperature profile looks saison-ish, so lets stick the fermenter upstairs, turn off the A/C, and let-er-rip". Turns out this was not one of my better ideas...details below.
Appearance: The colour is a little dark, I'm guessing because the sugar I prepared for this batch was a little darker than I intended. Instead of the usual light-straw colour, this beer leans towards the dark straw/copper end of the spectrum. Like most sainsons it is cloudy, and the wheat in it gives it a rocky head - one so rocky that it breaks up into little islands half way through the pint.
Aroma: Bread, followed by bread, with a subtle hint of bread in the background. Jokes aside, it is very bready on the nose, with a fruity - almost citrusy - undertone. The aroma itself is acidic, and tingles when you inhale.
Flavour: Remember in the intro where I said my approach to fermentation temperatures was not a good idea. This is where you notice that. Sainson's are supposed to be fruity, but there is fruity and then there is FRUITY. This beer has more than enough fruity esters - a clear sign that it was too warm early in the ferment (apparently the weather gods didn't get my memo about how quickly I wanted them to ramp up the heat). Its not at the point that it is unpleasant, but it is at the point where its a flaw rather than a "fruity saison". The fruitiness itself is pears & grapes - if in a better balance with the beer they would be dead-on style. The phenolic notes are toned down compared to what is normal, with the typical "drying" earthy-peppery phenolics of this yeast being present but quite subdued. I'm actually happy with this aspect of the beer - while I enjoy phenolics, the amounts typically produced by the Saison Dupont yeast are usually more than I care for. The underlying body of the beer is great - a nice bready wheat character with a hint of a biscuit note and right amount of bitterness. The only thing it is missing is a bit more hop character - a late addition of some more Saaz hops, which would add a nice herbal character, would complement the phenoics and provide some more balance to the fruit. Alternatively, if fermented at a more reasonable temperature (i.e. was less fruity), a late addition of Nelson Sauvin and Amarillo Gold would add a nice white wine & citrus/orange character that would work well with the base beer.
Mouthfeel: Light bodied and dry, just as a saison should be. It s a little under-carbonated for the style, but effervescent enough to be pleasant.
Overall: I can see why this recipe was an award-winner; it is a damned good beer and is a beer worth re-brewing - with proper temperature control, of course. Despite its fruitiness it is still a great, refreshing pint of beer at the end of a hot day.
Appearance: The colour is a little dark, I'm guessing because the sugar I prepared for this batch was a little darker than I intended. Instead of the usual light-straw colour, this beer leans towards the dark straw/copper end of the spectrum. Like most sainsons it is cloudy, and the wheat in it gives it a rocky head - one so rocky that it breaks up into little islands half way through the pint.
Aroma: Bread, followed by bread, with a subtle hint of bread in the background. Jokes aside, it is very bready on the nose, with a fruity - almost citrusy - undertone. The aroma itself is acidic, and tingles when you inhale.
Flavour: Remember in the intro where I said my approach to fermentation temperatures was not a good idea. This is where you notice that. Sainson's are supposed to be fruity, but there is fruity and then there is FRUITY. This beer has more than enough fruity esters - a clear sign that it was too warm early in the ferment (apparently the weather gods didn't get my memo about how quickly I wanted them to ramp up the heat). Its not at the point that it is unpleasant, but it is at the point where its a flaw rather than a "fruity saison". The fruitiness itself is pears & grapes - if in a better balance with the beer they would be dead-on style. The phenolic notes are toned down compared to what is normal, with the typical "drying" earthy-peppery phenolics of this yeast being present but quite subdued. I'm actually happy with this aspect of the beer - while I enjoy phenolics, the amounts typically produced by the Saison Dupont yeast are usually more than I care for. The underlying body of the beer is great - a nice bready wheat character with a hint of a biscuit note and right amount of bitterness. The only thing it is missing is a bit more hop character - a late addition of some more Saaz hops, which would add a nice herbal character, would complement the phenoics and provide some more balance to the fruit. Alternatively, if fermented at a more reasonable temperature (i.e. was less fruity), a late addition of Nelson Sauvin and Amarillo Gold would add a nice white wine & citrus/orange character that would work well with the base beer.
Mouthfeel: Light bodied and dry, just as a saison should be. It s a little under-carbonated for the style, but effervescent enough to be pleasant.
Overall: I can see why this recipe was an award-winner; it is a damned good beer and is a beer worth re-brewing - with proper temperature control, of course. Despite its fruitiness it is still a great, refreshing pint of beer at the end of a hot day.
Friday, 4 July 2014
2014 Hop Garden
Its been a while since I posted, but in my defence I was away on holiday and had bigger fish to fry. While I was away y hop garden really took off, so I thought I'd post a few shots.
|
|
|
Saturday, 31 May 2014
Shipwrecked - more way then one.
![]() |
| The third attempt to dissolve the sugar - still visible in the bottom of the jar. The original sugar was somewhat darker than this. |
Its time for some summer beers, so on the docket today is a classical saison. Because I'm pressed for time I didn't formulate my own recipe, and instead I am brewing this the "Shipwrecked Sainson" from HBT. No changes were made to the recipe, other than I'm using cultured Dupont Saison yeast and I once again made my own candi sugar - this time amber instead of dark.
If you've followed my older posts on homemade candi sugar (Posts 1, 2) you'll know that the usual product of this process is a block of candi sugar. This time I tried to make a syrup by adding ~400ml of water (for 460g sugar) at the end of the process; but instead of a nice syrup I instead ended up with a jar of half syrup and half solid sugar - sugar which was almost impossible to re-dissolve. Instead of being a time saver, this has instead become a time-suck. It took a few rounds off adding boiling water and heating/scraping to get it all in the brew (picture to left).
Making the amber sugar was quite easy, and produced a product similar in flavour to pancake syrup, but without the butteriness. The process:
- 400g of sugar was dissolved in water and inverted, as per my prior posts
- After inversion the sugar was warmed to 135C and 15ml of 1M lye was added
- Within 1 or 2 minutes colour/flavour development hit the desired level.
- 400ml of water was added to make a syrup, which as mentioned above, failed miserably...
Anyways, that's all I have time to write today. I'll be sure to follow up with some tasting notes in a month or so.
Now, off to clean the truck...
Sunday, 4 May 2014
Tasting Notes: Black Mamba Rye IPA
![]() |
| A pint of Black Mamba |
Appearance: Dark, dark and dark. Pours with a fluffy white head that dissipates over a few minutes.
Aroma: Cascade dominates the aroma. I'm not sure if its the beer's formulation, or because the hops were home grown, but the dank aspect of the hops comes through much more than the citrus/grapefruit character.
Flavour: Cascade plus hop bitterness is in the fore - a grapefruit & resinous hop flavor dominates, balanced with a smooth but strong hop bitterness (the smoothness, I think, is due to the use of first wort hopping). The dark malts and rye are in the background, but are noticeable and create an interesting mix or rye crispness and chocolate flavours. The use of dehusked Carafa Special II creates a unique flavour profile - roast notes, chocolate-like in nature, but without the astringency that normally comes along with the use of classical dark malts. This beer used the legendary Conan yeast, and while the yeast worked well with the beer none of the notes I was expecting are apparent - perhaps they ended up buried behind the strong hop schedule and rye/roasted malt character. That's not to say the yeast have detracted from the beer, but rather that the yeast character I was expecting is somewhat subdued. The after taste is a mostly hop bitterness plus a lingering dank/citrus flavour from the hops.
Mouthfeel: Light in body, like an IPA should be, and effervescent. Crisp & refreshing; no drying astringency or any other detractors. If this wasn't 7% alcohol it would be a great session beer.
Overall: A fantastic beer which is a real pleasure to drink. Black IPAs may just have become one of my favourite beer styles...
Saturday, 3 May 2014
Holy Pellicle, Batman!
The 1-2-3-4 is brewing away strongly, and the huge brett pitch combined with the use of a semi-open fermenter has led to the formation of one heck of a pellicle (click picture for the full-resolution glory). I wish I had grabbed a shot a few days earlier - flocks of Saccharomyces were duelling for space with Brettanomyces doing its best to setup shop on top of the beer. Primary fermentation is complete, so the Saccharomyces lost the battle as it always does, but it fought a valiant fight!
Some may wonder why I'm using a "semi-open" fermenter for this (by semi-open I mean a large bucket with a loose fitting lid). The reason is simple - many of the wonderful esters made by Brett require the presence of oxygen - the loose lid and large surface area will ensure plenty of oxygen makes it to the pellicle.
Friday, 25 April 2014
Easy as 1-2-3-4: a Rye Berliner Weiss
Last summer I prepared a fantastic sour-mashed Berliner Weiss. It was so good that I swore I'd brew at least 2 batches of it this summer, so its time to get going. But with a lot of changes. The last Berliner Weiss was as basic as you can get - 1:1 barley:wheat, sour mashed, and fermented with 1056. This year that is all going to change.
A big part of this change was motivated by a Berliner Weiss brewed by Justin, a fellow brewer in the London Homebrewers Guild. He used a bit of rye in his Berliner Weiss, and it worked incredibly well; the dry/crisp character of the rye fit in perfectly well with the sourness & dryness of the Berliner Weiss. The second big change I am making is the use of multiple yeast/bacterial cultures; instead of getting my lacto from a handful of uncrushed malt, I'm using an innoculum of lacto from my yeast bank (#91, Lactobacillus buchneri). I am doing this in the hope of avoiding some of the harsher bacterial tones I got last summer (likely from enterobacteria) - they eventually faded, but were unpleasant while they persisted. After boiling, I will be fermenting with a mix of Saccharomyces and Brettanomyces (yeast bank #111, 133 & 134) ; all three strains having been isolated from a commercial Berliner Weiss.
This unusual approach is also meant to deal with another issue - between starting the yeast cultures and the planned brew day - Saturday - SWIMBO and I decided to go camping. I'm hoping that the pitching of ~50ml of active lacto culture Tuesday night will sour things enough to finish the brew on Thursday...I'm hoping it will work, but either way this is the plan.
Why 1-2-3-4 you ask? Its easy - 1:2:3 is the rye:wheat:pilsner malt ratio of the beer, and it took 4 microorganisms to ferment it out!
Recipe & Brewing Notes Below the Fold...
A big part of this change was motivated by a Berliner Weiss brewed by Justin, a fellow brewer in the London Homebrewers Guild. He used a bit of rye in his Berliner Weiss, and it worked incredibly well; the dry/crisp character of the rye fit in perfectly well with the sourness & dryness of the Berliner Weiss. The second big change I am making is the use of multiple yeast/bacterial cultures; instead of getting my lacto from a handful of uncrushed malt, I'm using an innoculum of lacto from my yeast bank (#91, Lactobacillus buchneri). I am doing this in the hope of avoiding some of the harsher bacterial tones I got last summer (likely from enterobacteria) - they eventually faded, but were unpleasant while they persisted. After boiling, I will be fermenting with a mix of Saccharomyces and Brettanomyces (yeast bank #111, 133 & 134) ; all three strains having been isolated from a commercial Berliner Weiss.
This unusual approach is also meant to deal with another issue - between starting the yeast cultures and the planned brew day - Saturday - SWIMBO and I decided to go camping. I'm hoping that the pitching of ~50ml of active lacto culture Tuesday night will sour things enough to finish the brew on Thursday...I'm hoping it will work, but either way this is the plan.
Why 1-2-3-4 you ask? Its easy - 1:2:3 is the rye:wheat:pilsner malt ratio of the beer, and it took 4 microorganisms to ferment it out!
Recipe & Brewing Notes Below the Fold...
Wednesday, 23 April 2014
Tasting Notes: African Queen
A few weeks ago I brewed an experimental stout for a brewing challenge offered by my brew club. The challenge concept was simple - Iron Brewer; brew a beer using two ingredients drawn from a cap. I was lucky and got amaretto and grand marnier; almond and orange liquors which I worked into a stout.
The vision for the stout was a digestive; much like the liquors going into the beer. As such I wanted something bold, silky smooth and with a robust flavour and a balancing sweetness. This led to a stout recipe which had a lot of dark malts (60SRM's worth), was mashed high to provide body, and which had equal amounts of each liquor added twice - at flame-out & at kegging.
I almost got what I wanted - the liquor balance could be better; instead of the 1:1 ratio I would have used 2:1 orange:almond, as the orange is too subtle and the almond bitterness is too strong. I would also increase the amount of total liquor by as much as 2-fold. In addition, I would add the lactose I had meant to add (but forgot to order) - the body is nice, but the silkiness of lactose would be a fantastic addition.
Nitty-gritty below the fold.
The vision for the stout was a digestive; much like the liquors going into the beer. As such I wanted something bold, silky smooth and with a robust flavour and a balancing sweetness. This led to a stout recipe which had a lot of dark malts (60SRM's worth), was mashed high to provide body, and which had equal amounts of each liquor added twice - at flame-out & at kegging.
I almost got what I wanted - the liquor balance could be better; instead of the 1:1 ratio I would have used 2:1 orange:almond, as the orange is too subtle and the almond bitterness is too strong. I would also increase the amount of total liquor by as much as 2-fold. In addition, I would add the lactose I had meant to add (but forgot to order) - the body is nice, but the silkiness of lactose would be a fantastic addition.
Nitty-gritty below the fold.
Sunday, 30 March 2014
Brew day - Black Mamba Rye IPA
One week after the Iron Brewer Challenge it is time for another brew-day - this time without weird adjuncts. On today's menu is the Black Mamba Rye IPA - a bold, strong black IPA featuring a hefty dose of rye malt and the crispness that brings to a beer. In addition, todays brew sees the end of the Cascade hops (about 1oz) that I grew last summer. Indeed, this beer is a celebration of Cascade - other than a bit of Warrior for bittering & a touch of a late addition, all of the hop flavour and aroma will be from Cascade.
This recipe is largely one of my creation and is meant to be simple - the classical Black IPA grains of Victory malt (or Special malt; I have victory on-hand), dehusked dark malt (Carafa Special II), mixed with a 2.5:1 mix of pale malt and rye; typical of many rye-based beers. The mash is low-and-slow, to give a dry-finishing beer. With the rye this may lead to a too-dry finish, but I have taken two steps to balance that out - I hope. The first is relying on cascade as a hop - it should give a spicy/citrusy character that will provide a balancing fruitness to the beer. I am then accentuating that using the legendary Conan yeast, which should provide some additional fruity esters - notably apricot - to further balance the crispness of the rye and the highly fermentable wort.
Recipe & brew-day notes below the fold
This recipe is largely one of my creation and is meant to be simple - the classical Black IPA grains of Victory malt (or Special malt; I have victory on-hand), dehusked dark malt (Carafa Special II), mixed with a 2.5:1 mix of pale malt and rye; typical of many rye-based beers. The mash is low-and-slow, to give a dry-finishing beer. With the rye this may lead to a too-dry finish, but I have taken two steps to balance that out - I hope. The first is relying on cascade as a hop - it should give a spicy/citrusy character that will provide a balancing fruitness to the beer. I am then accentuating that using the legendary Conan yeast, which should provide some additional fruity esters - notably apricot - to further balance the crispness of the rye and the highly fermentable wort.
Recipe & brew-day notes below the fold
Simple Hop Spider
![]() |
| BYO's hop spider |
One simple invention that has come along since then is the hop spider. For those who haven't heard of these, the retain pellet hops in the boil, reducing the amount of trub you have to deal with post-boil and preventing clogging of your system. The classic hop spider is a 4" to 3" PCV coupler with 3 or 4 carriage bolts sticking out of the wide portion and a fine mesh bag held onto the bottom with a screw-clamp (see image above). While a brilliant invention, I've always disliked them for two reasons - the get in the way of the lid, and the sized bag usually used concentrates the hops; IMO, likely reducing alpha acid extraction efficiency. Moreover, it doesn't let you adapt to different sized batches in your brewpot.
My hop spider (details below the fold) overcomes these issues - and costs less to build to boot!
Saturday, 22 March 2014
Iron Brewer Challenge - African Queen Stout
So its been a while since I've brewed - and to be honest - its been a while since I've enjoyed a pint of beer. Between travel, two rounds of some pretty nasty bugs, and a crazy work schedule life hasn't been friendly to my brewing hobby.
So its damned well time I brew a beer! Even better, todays beer is another "brewing challenge" set by my homebrew club, the London Homebrewers Guild. This will be the fourth such brew I've participated in - the previous ones being a SMaSH challenge, the now infamous grocery store challenge, and and advent brew/beer exchange. This time we're doing an Iron Brewer challenge - like the Iron Chef TV show. Basically, you draw two ingredients out of a hat, and you must incorporate those into your brew.
Our list if ingredients was imaginative - but limited to things you'd find (or would find similar flavours), in beer: Grand Marnier, Cloves, Strawberries, Mint, Amaretto, Chocolate, Blueberry, Lemon, Lime, Honey, Vanilla, Baileys, and Oranges. Some of my fellow brewers received somewhat difficult combinations - strawberry & clove for example. I lucked out - Grand Mariner & Amaretto.
Based on those ingredients I started building a recipe, using cocktails as a basis for mixing my flavours. I originally started with a plan to mimic a B52 - grand marnier, amaretto and lactose (to mimic Irish cream) in a mildly hopped caramel-malt forward beer. But a few mixing the liquors into a commercial pale ale revealed that this would not be a good idea. I then began thinking about dark beers, with their intense roasted flavour. These can be quite similar to coffee & chocolate in their flavour profile, and coffee and chocolate often go well with grand marnier and amaretto. A bit of research found a hot coffee drink - an African Queen - comprised of coffee, grand marnier, amaretto and a bit of whipped cream - AKA the original mix of liquors and lactose I was planning on. I can assure you that extensive testing of this beverage has convinced me that it should work well as a beer - so I planned out a roasty milk-stout (that got converted into a more dry-ish stout due to a shopping error) based on this wonderful coffee beverage.
Not wanting to make too much of this - in case it isn't as good as my porter + liquor tests suggested it would be - I planned a 5L batch, using brew-in-a-bag to prepare the beer. I also forgot to order lactose, so instead I'm doing a high-body mash (69C) to provide some sweetness to counter the bitter liquors I am adding. Lastly, I am adding the liquors at flame-out, to drive off their alcohol while retaining their flavours & aromatics. If I find their character too mild, I can "dry booze" with a little more before bottling.
Recipe & brew-day notes below the fold...
So its damned well time I brew a beer! Even better, todays beer is another "brewing challenge" set by my homebrew club, the London Homebrewers Guild. This will be the fourth such brew I've participated in - the previous ones being a SMaSH challenge, the now infamous grocery store challenge, and and advent brew/beer exchange. This time we're doing an Iron Brewer challenge - like the Iron Chef TV show. Basically, you draw two ingredients out of a hat, and you must incorporate those into your brew.
Our list if ingredients was imaginative - but limited to things you'd find (or would find similar flavours), in beer: Grand Marnier, Cloves, Strawberries, Mint, Amaretto, Chocolate, Blueberry, Lemon, Lime, Honey, Vanilla, Baileys, and Oranges. Some of my fellow brewers received somewhat difficult combinations - strawberry & clove for example. I lucked out - Grand Mariner & Amaretto.
Based on those ingredients I started building a recipe, using cocktails as a basis for mixing my flavours. I originally started with a plan to mimic a B52 - grand marnier, amaretto and lactose (to mimic Irish cream) in a mildly hopped caramel-malt forward beer. But a few mixing the liquors into a commercial pale ale revealed that this would not be a good idea. I then began thinking about dark beers, with their intense roasted flavour. These can be quite similar to coffee & chocolate in their flavour profile, and coffee and chocolate often go well with grand marnier and amaretto. A bit of research found a hot coffee drink - an African Queen - comprised of coffee, grand marnier, amaretto and a bit of whipped cream - AKA the original mix of liquors and lactose I was planning on. I can assure you that extensive testing of this beverage has convinced me that it should work well as a beer - so I planned out a roasty milk-stout (that got converted into a more dry-ish stout due to a shopping error) based on this wonderful coffee beverage.
Not wanting to make too much of this - in case it isn't as good as my porter + liquor tests suggested it would be - I planned a 5L batch, using brew-in-a-bag to prepare the beer. I also forgot to order lactose, so instead I'm doing a high-body mash (69C) to provide some sweetness to counter the bitter liquors I am adding. Lastly, I am adding the liquors at flame-out, to drive off their alcohol while retaining their flavours & aromatics. If I find their character too mild, I can "dry booze" with a little more before bottling.
Recipe & brew-day notes below the fold...
Tuesday, 18 March 2014
I get email...
While many of my readers reply directly here on my blog, I do get the occasional email asking questions in relationship to some of my posts. While a lot of these are simply requests for clarification, some are seeking details missing from posts, questions expanding on posts, and requests for posts/videos.
I've compiled a bunch of questions from various emailers, and answered them below.
Questions are divided by category:
I've compiled a bunch of questions from various emailers, and answered them below.
Questions are divided by category:
- Mailing Yeasts
- Wild Brewing
- Yeast Wrangling
Saturday, 15 March 2014
Better Late Then Never - Hail Brett-tanian Tasting Notes
Way back in January I began an experiment to brew a porter fermented solely with Brettanomyces. This was a bit of a scary experiment as brett has a reputation for not playing nice with dark malts - the polyphenols in these malts can be converted by brett into other phenols - phenols which taste like burnt plastic, band-aids and dirt. In addition, brett tends to dry beers out, killing the balancing sweetness/mouthfeel that we look for when brewing with darker malts. If you read my original post you'll see I did a number of things to reduce the risk of these issues - using dehusked dark malts, adding oats for mouthfeel, carefully controlling the sparge temperature, and so on.
Since posting about that brew a lot of my friends have been bugging me for a follow-up. But between travel, work and a couple nasty bugs, I've not been able to get around to a post - and to tell the truth, for most of the intervening time, I've not been able to taste or smell anything for most of that time anyways.
So how did it turn out? It is a good beer, but not exactly what I expected. . .then again, nothing about this beer after brew day was as expected....
Since posting about that brew a lot of my friends have been bugging me for a follow-up. But between travel, work and a couple nasty bugs, I've not been able to get around to a post - and to tell the truth, for most of the intervening time, I've not been able to taste or smell anything for most of that time anyways.
So how did it turn out? It is a good beer, but not exactly what I expected. . .then again, nothing about this beer after brew day was as expected....
Subscribe to:
Posts (Atom)

.gif)



























