Another Wild Yeast Identification Test

Micrograph of the Wild Yeast (left) versus
conventional ale yeast (right)

Over a series of posts, listed below, I've covered my work designing a method to identify what species I'm purifying in my attempts to isolate wild yeasts.  This technique has concentrated on the sequencing ribosomal DNA; stretches of DNA which are frequently sequenced for the purpose of species identification.  My first attempt at this did not work well, but I had a higher degree of success upon re-targeting my sequencing attempts to a different region of the ribosome.

In parallel with these experiments I have been purifying a range of wild strains (edit: completed here) which will soon be tested for their fermentation characteristics.  Once good brewing strains are identified, I will further characterize them - including identifying the species via ribosomal sequencing.

Before I go down that road I want to test the sequencing method on a bona fide wild strain.  For this test I am using a strain kindly provided by fellow wild brewer Doc_Drive.  This yeast was featured in an earlier post of mine as an example of suing old yeast-identification methods.  In this post I tentatively identified this yeast as Kloeckera apiculata based on its morphology and described fermentation characteristics.

I have now positively identified this yeast as Kloeckera, based on ribosomal sequencing; the full story can be found below the fold...yes, I was right!

---

Approach:

Something isn't right...

Left: Ladder

Middle: ITS PCR

Right: 26s PCR

As per usual, this trial starts with a DNA isolation - in this case I tried the simplest method available; a small amount of yeast was suspended in 100ul of water, and boiled for 15 minutes.  The solution was then centrifuged to pellet any cell debris.  I then PCR amplified both sections of the ribosome I have primers for (e.g. the 'old' (ITS) and 'new' (26s) primers), using a 49C annealing temperature and 45 amplification cycles.  When run on a gel, I got the picture on the left.

The resulting bands were then purified, and sent for sequencing.  Due to the small amounts of DNA present, I didn't get a good sequence off of the NS1 primers.  The ITS primers gave the following sequences on NCBI Blast:

PCR	Sequence	Identification
ITS	ATGTTGCTGCGTTGGGAAGCGAAGCTGGCGGCACTTTGTACGGTTTGCAGGTACTGgacNgNATtGaAgCAAATC AGCGACAAAACTTCACCCGATTTGTGGTGTTGGCGCGTAAAGCCATTAACGTGTCTGATCAGGTTCCGGCGAAAA CCACGTTGTTAATGGCGACCGGGCAACAAGCCGGTGCGCTGGTTGAAGCGTTGCTGGTACTGCGCAACCACAATC TGATTATGACCCGTCTTGAAACACGGACCANNGGGCACAGGCTGGAGGACAGACGGGGGTTGCCAGGTGGCTCTG GGACAAGCCCAAGCTGCTCCCTGAAGGTTTCCCTCTTT	Escherichia coli P12b

Well shit, not what I was hoping for.  Looks like somewhere in the mailing/reculturing chain some nasty bacteria got in - guess that's what I get for not using an antibiotic containing plate.

---

So I streaked out my stored 'yeast' on an antibiotic plate, repeated the sequencing and got the following:

PCR	Sequence	Identification
ITS	aaaccaactg ggattacctt agtaacggcg agtgaagcgg taaaagctca aatttgaaat ctggtacttt cagtgcccga gttgtaattt gtagaatttg tctttgatta ggtccttgtc tatgttcctt ggaacaggac gtcatagagg gtgagaatcc cgtttggcga ggataccttt tctctgtaag actttttcga agagtcgagt tgtttgggaa tgcagctcaa agtgggtggt aaattccatc taaagctaaa tattggcgag agaccgatag cgaacaagta cagtgatgga aagatgaaaa gaactttgaa aagagagtga aaaagtacgt gaaattgttg aaagggaagg gcatttgatc agacatggtg ttttttgcat gcactcgcct ctcgtgggct tgggcctctc aaaaatttca ctgggccaac atcaattctg gcagcaggat aaatcatt	Hanseniaspora uvarum

It worked!  Not only did it work, but my first tentative identification of the yeast - based on morpholog & a bit of a description of where the yeast was found - ended up being right!  It is hanseniasporia - AKA the Kloeckera I had tentatively identified it as before.