Yeast Identification Test

A short while ago I wrote a post on a fairly technical method to identify wild (and not-so-wild) yeast. This method relies on sequencing a short piece of the yeasts genome; this sequence is then used to ID the yeast. In this article I am going through an example of this method, aiming to demonstrate the operation of this methods. Sadly, we have no official wild yeasts in this example, but we do have a few strains of Brett as well as a yeast sample from a batch of beer that may or may not have been contaminated. Specifically, I am testing:

• Wyeast 1084 (Irish ale); a run-of-the-mill Saccharomyces cerevisiae strain of yeast.
• White Labs Brettanomyces lambicus
• White Labs Brettanomyces bruxellensis
• A mystery yeast from my Guilds president - its either White Labs Yorkshire Square, or a yeast which contaminated his latest brew.

Details below the fold...

---

The PCR

For this example I am looking at five yeasts - Wyeast 1084 (Saccharomyces cerevisiae, Irish Ale), Brettanomyces lambicus & Brettanomyces bruxellensis from White Labs, and a (possibly) wild yeast that invaded the London Homebrewers Guild president's last couple batches of beer...

In all cases, 1ml samples of larger cultures being prepared for either freezing or brewing were taken, the DNA, and a PCR performed on the purified DNA. The PCR was done as follows:

• A 30ul PCR reaction was setup using PFU polyerase, 0.5ul of the ITS1 and ITS4 primers (stock solution = 100uM) and 1ul of purified DNA.
• The samples were run through 45 rounds of PCR amplification; each cycle was comprised of: 30sec at 98C, 30sec at 50C, 1min at 72C.
• The PCR products were then run on a gel to visualize & purify the fragments

First Attempt.

In the first attempt only the Brett produced any bands. It is unclear at this point why this happened - but I suspect I mis-measured or mis-mixed the last two samples.

The gel to the left shows the result of the first PCR attempt. These gels separate DNA pieces by size, with the largest pieces at the top. The left-most lane is a DNA ladder - essentially a mix of DNA pieces of known size. If you go up the ladder from the bottom you'll hit a gap - the band in the middle of the gap is 1500 base pairs (bp) in size; the one below it 1000bp. Every band below the 1000bp is 100bp smaller than the one above. The bright bands between 400bp and 500bp in the two lanes to the right of the ladder are the ITS regions from B. bruxellensis and B. lambicus. B. bruxellensis has an ITS of ~450bp in length, while B. lambicus is slightly larger (but less than 500bp). Brett lanes should have been the ITS regions from 1084 and the mystery yeast in my brew clubs president's beer. The fainter bands are minor products that are no uncommon when using an annealing temperature of 50C (55-0C are more common). The blank two lanes to the right of the

1084 ITS

I repeated the 'presidential' and 1084 PCR reactions, using double the yeast DNA just in case the DNA quantity was limiting last time. I was also extra-anal about mixing the reactions, and dropped the annealing temperature from 50C to 49C. This second attempt is shown to the right. Only the 1084 worked (I cropped the 'presidential' lane). Here, the ITS region is only around 350bp; roughly 100bp shorter then Brett. I re-repeated the presidential PCR, using an annealing temperature of only 45C; still no band. A third attempt also failed - whatever is in their is either indestructible, or so far removed from being a yeast as to be unidentifiable....

---

Sequencing Results:

The purified DNA was sequenced, producing the following result:

Sample	DNA Sequence	Species
Wyeast 1084	CTGTGTGGGCGCACAAAACACCTAAACCTGGAGTATACACACGTCAACAAaaga tcTAAAAGAATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAG AGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAG TTCTTGAACGCACATTGCGCCCGTCGGTATTCCGGCGGGCATGCCTGTCTGAGC GTCGTTTCCTTCTTGTGCACCGGGGTCTTTGCAGATCCTCTCTGCGCAGAGCTG GCCGTGCCACTGGCCCGGCCGAAAAGAAACGTTGCGGACGAAGCGAACTACATC GGGACGCTTTGGCCGCCGAGCGAAAAAAAAACACCATTGAGCTCNACCTCAGAT CAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAA	Saccharomycetes sp. HZ94
B. lambicus	CTGTGTGGGCGCACAAAACACCTAAACCTGGAGTATACACACGTCAACAAaa gatctaAaagaatAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGAT GAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATC ATCGAGTTCTTGAACGCACATTGCGCCCGTCGGTATTCCGGCGGGCATGCCT GTCTGAGCGTCGTTTCCTTCTTGTGCACCGGGGTCTTTGCAGATCCTCTCTG CGCAGAGCTGGCCGTGCCACTGGCCCGGCCGAAAAGAAACGTTGCGGACGAA GCGAACTACATCGGGACGCTTTGGCCGCCGAGCGAAAAAAAAACACCATTGA GCTCGACCTCAGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAA GCGGAGGAAAGGATNNTTANTGTGATTATACCNNNNNNCNCTGNGNGGGCGC ACAAAANANNNNANCCTGGAGTATACNCACGTCAANNAAAGANCTAAANNAA NANNACTTTCNANNANGGATCTCTTGGNTCTCNCATNGNTGAANAGCGCANC NAAANGCNNTAC	Pichia membranifaciens strain CBS 212
B. bruxellensis	CTGTGTGGGCGCACAAAACACCTAAACCTGGAGTATACACACGTCAACAAAAG atNNaaaagaAtAAAACTTTCAACAACGGATCTCTTGGTTCTCGCNTCGATGA AGAGCGCAGCGAAATGCGATACCTANTGTGAATTGCAGCCATCGTGAATCATC GAGTTCTTGAACGCACATTGCGCCCGTCGGTATTCCGGCGGGCATGCCTGTCT GAGCGTCGTTTCCTTCTTGTGCACCGGGGTCTTTGCAGATCCTCTCTGCGCAG AGCTGGCCGTGCCACTGGCCCGGCCGAAAAGAAACGTTGCGGACGAAGCGAAC TACATCGGGACGCTTTGGCCGCCGAGCGAAAAAAAAACACCATTGAGCTCGAC CTCNGATCAGGNAGGAGTACCCGCTGAACTTAAGCATATCAATAAGNGNAGGA ANNGAT	Pichia membranifaciens isolate NCL 53

So there you have it - one out of three worked...what the hell happened? The answer is two things - one is that the first 60% of the ITS is nearly identical between Sacch, Brett & Pichia. Because DNA search engines look for similarities, this biases results towards this common region. The second issue is species representation in the database. Sacch & Pichia (a plant pathogen) have thousands of sequenced strains in the database; as far as I can tell there is only a couple of Dekkera (another name for Brett) in the database. As such, the high number of Sacc & Pichia strains dominate, thus biasing our results.

What if we tell the search engine to look for Dekkera and only Dekkera? It works! B. brux is ID'd as "Dekkera bruxellensis", B. lamb is ID'd as "Dekkera bruxellensis strain ATCC 56866" (technically, B. lamb is a sub-strain of B. brux). So hey - if we know what we got, we can identify it. That's. . .less than useful.

A large part of the issue appears to be the over-abundance of some species which then bias our results. But we're not done yet - we know what sort of organisms are likely in beer; and blast lets us limit our results by genus or species (see red box in image to the right). So what do we get it we limit our search to a list of likelies? Specifically:

• Saccharomyces
• Pleurotus opuntiae
• Cryptococcus kuetzingii
• Candida krusei
• Pichia fermentans
• Rhodotorula mucilaginosa
• Dekkera
• Metschnikowia
• Schizosaccharomyces
• Hanseniaspora apiculata
• Zygosaccharomyces
• Aureobasidium
• Torulaspora
• Kluyveromyces

Everything comes up pichia & candida (damned pathogens, dominating a database). Exclude those and. . .it works! For the B. lamb and B. brux strains the first 25 & 28 hits are Dekkera or Brettanomyces. Searching 1084's sequence gives us the same hit as before. Yay!

---

Will This Actually Work?

The answer is . . . yes, so long as we include some classical methods. In most cases microscopy + DNA sequencing should be enough to ID the species: by using morphology we can reduce our list of possibles to something manageable, and then use DNA for the final identification. This weekend (as in, 2 days from now) I'm beginning the first real test of this sample - I'm beginning a fully wild ferment using uncrushed malted barley as a source material. With luck, in a few weeks, I'll have a legitimate example to post.

---

A Note on DNA Sequences.

Example of a DNA sequencing error.
The small peaks are good sequence
reads, the large peaks lead to errors.

The more vigilant may have noticed a series of 'N's in the DNA sequence. But DNA is made of A, T, C, &G's. What's going on? It has to do with the Sanger method used to sequence DNA. In short, this method uses PCR to copy DNA, but adds to the mix a small number of DNA bases which have a fluorescent molecule of a specific colour attached where the next DNA base would normally be added. When these get incorporated into the DNA, they stop the PCR reaction. Because this process is random, and the fluorescent DNA bases are rare, you end up with a mix of different lengths of DNA, each terminated by a single coloured DNA base. By separating these pieces by size, then 'reading' the colour of each piece, we assemble the sequence.

On occasion, errors happen - an incorrect colour gets incorporated, random gunk creates a fluorescent blob, etc. This creates ambiguity in the DNA sequence. For example, in the above image there are neat, single colour peaks giving good sequence, but in the middle there are some overlapping red and green (which represent A's and T's) signals. This ambiguity creates two bases which cannot be identified; leading to two 'N' in the sequence.

---

Resources:

1. Conserved primer sequences for PCR amplification and sequencing from nuclear ribosomal RNA - webpage outlining primers and methods to ID yeast by sequencing.
2. Brewhouse-Resident Microbiota Are Responsible for Multi-Stage Fermentation of American Coolship Ale - Free scientific article on the yeasts/bacteria found in lambic-style beer & the use of sequencing primers to ID the species within the sample.
3. NCBI BLAST - search multiple DNA databases for genome sequences.
4. Yeast Genome Database - database of yeast & other fungi genomes, includes a BLAST feature.