tag:blogger.com,1999:blog-8081751738815878503.post7510233361942536446..comments2023-04-14T03:40:29.342-04:00Comments on Sui Generis Brewing: Another Wild Yeast Identification TestBryanhttp://www.blogger.com/profile/16672407110077541595noreply@blogger.comBlogger11125tag:blogger.com,1999:blog-8081751738815878503.post-55887627540161595682017-03-27T13:04:12.706-04:002017-03-27T13:04:12.706-04:00Inter-delta works well for sacch. I'm trying o...Inter-delta works well for sacch. I'm trying other methods that may work for sacch and other yeasts (e.g. brett). Nothing to report yet on the alternate methods.Bryanhttps://www.blogger.com/profile/16672407110077541595noreply@blogger.comtag:blogger.com,1999:blog-8081751738815878503.post-41173199945829915242017-03-27T12:55:14.931-04:002017-03-27T12:55:14.931-04:00I am going to try Interdelta PCR (http://onlinelib...I am going to try Interdelta PCR (http://onlinelibrary.wiley.com/doi/10.1016/S0378-1097(03)00205-2/full) and see if that works better. At a minimum I should be at least able to compare my isolated strain with strains in my library.Isomerizationnoreply@blogger.comtag:blogger.com,1999:blog-8081751738815878503.post-40407374678636884922017-03-23T12:59:46.139-04:002017-03-23T12:59:46.139-04:00It sounds like your PCR is working fine - ITS shou...It sounds like your PCR is working fine - ITS should be between 800 and 900 bp in size. The level of homology is lower than I would expect - I typically see 95% or higher - are you trimming the sequence to the best quality sequence?<br /><br />In terms of DMSO, I've not found it necessary, but different enzymes may benefit from it under standard ITS conditions.<br /><br />You cannot get strain-specific information from ITS sequences; only the species/genus gets identified. There are other PCR fingerprinting methods for strain-typing saccharomyces, but I've done minimal experimentation with those and do not know how well they work.Bryanhttps://www.blogger.com/profile/16672407110077541595noreply@blogger.comtag:blogger.com,1999:blog-8081751738815878503.post-85404745110608381922017-03-23T11:53:12.639-04:002017-03-23T11:53:12.639-04:00I'm not sure if you will see this comment sinc...I'm not sure if you will see this comment since this post is so old, but I felt it best to go here! If I don't see a response, I will repost on your latest entry.<br /><br />I am trying to identify a yeast cultured from a commercial source. After streaking out the yeast and letting it grow for a couple days at 30C, I then used the PCR method you outlined in your blog (ITS1/4 primers).<br /><br />I gel extracted the only band (side note: do you include DMSO in your PCR reaction? I find that helps reduce laddering, among other issues, quite a bit!), which was a bit larger than 800 bp. I sent this for DNA sequencing. When I BLAST the resulting sequence (chromatogram looks good), I get S. cerevisae hits (only about 89% identical though over the 800 bp).<br /><br />My real question is, how can I figure out what type of Sacc this is? Or most closely related to? I am going to do some test fermentations with this isolate, but I was perhaps naively hoping to at least figure out what type of yeast this was at the genetic level first...Isomerizationnoreply@blogger.comtag:blogger.com,1999:blog-8081751738815878503.post-62228929118254018942013-10-01T03:34:55.886-04:002013-10-01T03:34:55.886-04:00This is great information, thanks’ for share!This is great information, thanks’ for share!lap dat camerahttp://thietbivienthongbachkhoa.com/Default.asp?mod=ProductType&action=list&TypeID=277&temp=Vertuvn_vn&Object=8&ItemID=277&Language=vnnoreply@blogger.comtag:blogger.com,1999:blog-8081751738815878503.post-26893348883014359872013-08-21T10:03:37.338-04:002013-08-21T10:03:37.338-04:00I am using home-made PFU, but with a commercial bu...I am using home-made PFU, but with a commercial buffer. I am not adding additional Mg+. It contains:<br />200 mM Tris-HCl (pH 8.8), 100 mM (NH4)2SO4, 100 M KCl, 1% (v/v) Triton X-100, 1 mg/mL BSA.Bryanhttps://www.blogger.com/profile/16672407110077541595noreply@blogger.comtag:blogger.com,1999:blog-8081751738815878503.post-3863741493288643752013-08-20T16:55:43.974-04:002013-08-20T16:55:43.974-04:00Are you using a master mix or making your own? Wh...Are you using a master mix or making your own? What Mg+ concentration?Anonymoushttps://www.blogger.com/profile/13816208251467621004noreply@blogger.comtag:blogger.com,1999:blog-8081751738815878503.post-42588012525863255642013-08-19T09:34:28.466-04:002013-08-19T09:34:28.466-04:00I used the NS primers outlined in my older post:
...I used the NS primers outlined in my older post:<br /><br />NS 1: 5' - GCATATCAATAAGCGGAGGAAAAG - 3'<br />NS 4: 5' - GGTCCGTGTTTCAAGACGG - 3'<br /><br />45 cycles is about the maximum number most PCR enzymes can handle, and with smaller products like the one sequenced here, can greatly improve yield. Especially when starting with the trace amounts of DNA that I have using the boil-method to recover yeast DNA.<br /><br />I do not remember how much DNA I recovered off hand, but it was enough that I had to dilute it 1:5 or so to reduce the concentration to what the sequencing lab prefers (10-20ng/ml).Anonymoushttps://www.blogger.com/profile/04328503299729327430noreply@blogger.comtag:blogger.com,1999:blog-8081751738815878503.post-43994297304003941392013-08-17T12:16:23.174-04:002013-08-17T12:16:23.174-04:00Congrats on your Kloeckera results. Did you use th...Congrats on your Kloeckera results. Did you use the following primers for this identification: NS1 (GCATATCAATAAGCGGAGGAAAAG), NS4 (GGTCCGTGTTTCAAGACGG)?<br /><br />Never did a PCR with 45 cycles before. I would expect a lot of product after so many cycles. How much DNA could you isolate from the gel?eurekabrewinghttp://eurekabrewing.wordpress.com/noreply@blogger.comtag:blogger.com,1999:blog-8081751738815878503.post-48585298473223054482013-08-15T09:47:59.171-04:002013-08-15T09:47:59.171-04:00The method does seem to be working. And with the ...The method does seem to be working. And with the low cost of sequencing and PCR, is becoming more affordable by the day!Bryanhttps://www.blogger.com/profile/16672407110077541595noreply@blogger.comtag:blogger.com,1999:blog-8081751738815878503.post-10658678848422948362013-08-14T21:42:13.756-04:002013-08-14T21:42:13.756-04:00Nicely done. I have been toying with ITS PCR and R...Nicely done. I have been toying with ITS PCR and RFLP for differentiating Brett and Sacc. I like your approach and may start to send off for sequencing.Anonymoushttps://www.blogger.com/profile/13816208251467621004noreply@blogger.com